Stem-loop sequence mmu-mir-330

AccessionMI0000607 (change log)
Symbol MGI:Mir330
DescriptionMus musculus miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop
   gacccuuu   -  u u           --    -    u   ag    uucaa 
5'         ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
           ||| || | |||||||||||  |||| |||| |||  ||||     a
3'         ucg cu g gauggagagac  ccgg acac gaa  cgag     u
   -------c   u  c c           gu    g    -   -a    caacc 
Get sequence
Deep sequencing
34651 reads, 68.4 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 19181465-19181562 [+]
sense
OTTMUST00000072384 ; Eml2-002; intron 1
OTTMUST00000072386 ; Eml2-004; intron 1
OTTMUST00000072385 ; Eml2-003; intron 1
OTTMUST00000072387 ; Eml2-005; intron 1
OTTMUST00000072388 ; Eml2-006; intron 1
OTTMUST00000072389 ; Eml2-007; exon 1
OTTMUST00000072383 ; Eml2-001; intron 4
ENSMUST00000141792 ; Eml2-007; exon 1
ENSMUST00000141718 ; Eml2-006; intron 1
ENSMUST00000144054 ; Eml2-005; intron 1
ENSMUST00000048502 ; Eml2-003; intron 1
ENSMUST00000148246 ; Eml2-004; intron 1
ENSMUST00000120595 ; Eml2-002; intron 1
ENSMUST00000117338 ; Eml2-001; intron 4
Database links

Mature sequence mmu-miR-330-5p

Accession MIMAT0004642
Previous IDsmmu-miR-330
Sequence

22 - 

ucucugggccugugucuuaggc

 - 43

Get sequence
Deep sequencing7083 reads, 72 experiments
Evidence experimental; cloned [1-2], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-330-3p

Accession MIMAT0000569
Previous IDsmmu-miR-330;mmu-miR-330*
Sequence

61 - 

gcaaagcacagggccugcagaga

 - 83

Get sequence
Deep sequencing27560 reads, 75 experiments
Evidence experimental; cloned [1-2], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).