|
miRBase |
|
Stem-loop sequence rno-mir-330 |
|||||
| Accession | MI0000606 | ||||
| Description | Rattus norvegicus miR-330 stem-loop | ||||
| Gene family | MIPF0000200; mir-330 | ||||
| Stem-loop |
acccuuu - u u -- - u ag uucaa ggc ga c cugccucucug ggcc ugug cuu gcuc g ||| || | ||||||||||| |||| |||| ||| |||| a ucg cu g gauggagagac ccgg acac gaa cgag u ------c u c c gu g - -a caauc |
||||
| Comments |
The mature miRNA originating from the 3' arm reported in [1] contains an extra 3' A residue, which conflicts with the precursor sequence shown here. Landgraf et al. show that the 5' miRNA is the predominant one [2]. The 3' mature sequence is renamed miR-300* here. |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence rno-miR-330-5p |
|
| Accession | MIMAT0004641 |
| Previous IDs | rno-miR-330 |
| Sequence |
21 - ucucugggccugugucuuaggc - 42 |
| Evidence | experimental; cloned [2], SOLiD [3] |
| Predicted targets |
|
Mature sequence rno-miR-330-3p |
|
| Accession | MIMAT0000568 |
| Previous IDs | rno-miR-330;rno-miR-330* |
| Sequence |
60 - gcaaagcacagggccugcagaga - 82 |
| Evidence | experimental; cloned [1], SOLiD [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|