Stem-loop sequence rno-mir-330

Accession MI0000606
Description Rattus norvegicus miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop 
acccuuu   -  u u           --    -    u   ag    uucaa 
       ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
       ||| || | |||||||||||  |||| |||| |||  ||||     a
       ucg cu g gauggagagac  ccgg acac gaa  cgag     u
------c   u  c c           gu    g    -   -a    caauc
Get sequence
Comments

The mature miRNA originating from the 3' arm reported in [1] contains an extra 3' A residue, which conflicts with the precursor sequence shown here. Landgraf et al. show that the 5' miRNA is the predominant one [2]. The 3' mature sequence is renamed miR-300* here.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
1: 78544318-78544414 [+]
sense
ENSRNOT00000067473 ; EMAL2_RAT; intron 1
ENSRNOT00000067214 ; D3ZNJ7_RAT; intron 1
ENSRNOT00000067473 ; EMAL2_RAT; intron 1
ENSRNOT00000067214 ; D3ZNJ7_RAT; intron 1
ENSRNOT00000067473 ; EMAL2_RAT; intron 1
ENSRNOT00000067214 ; D3ZNJ7_RAT; intron 1
ENSRNOT00000041215 ; Eml2; intron 4
ENSRNOT00000041215 ; Eml2; intron 4
ENSRNOT00000041215 ; Eml2; intron 4
Database links
  • ENTREZGENE: 100313974;Mir330

Mature sequence rno-miR-330-5p

Accession MIMAT0004641
Previous IDs rno-miR-330
Sequence

21 -  

ucucugggccugugucuuaggc

 - 42

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-330-3p

Accession MIMAT0000568
Previous IDs rno-miR-330;rno-miR-330*
Sequence

60 -  

gcaaagcacagggccugcagaga

 - 82

Get sequence
Evidence experimental; cloned [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).