Stem-loop sequence rno-mir-329

AccessionMI0000604 (change log)
DescriptionRattus norvegicus miR-329 stem-loop
Gene family MIPF0000110; mir-329
Literature search

12 open access papers mention rno-mir-329
(20 sentences)

Stem-loop
   uguucgcuuc      c            uu      cuc      -   g 
5'           ugguac ggaagagagguu  cugggu   uguuuc uuu a
             |||||| ||||||||||||  ||||||   |||||| ||| u
3'           acuaug cuuuuuuuccaa  gaccca   acaaag aag g
   -----ccuaa      a            uc      --c      u   a 
Get sequence
Deep sequencing
49361 reads, 6.87 reads per million, 364 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MI0000605).

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133862168-133862264 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-329
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
Database links

Mature sequence rno-miR-329-5p

Accession MIMAT0017031
Previous IDsrno-miR-329*
Sequence

23 - 

agagguuuucugggucucuguuuc

 - 46

Get sequence
Deep sequencing32027 reads, 334 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-329-3p

Accession MIMAT0000566
Previous IDsrno-miR-329
Sequence

61 - 

aacacacccagcuaaccuuuuu

 - 82

Get sequence
Deep sequencing17319 reads, 285 experiments
Evidence experimental; cloned [1], Northern [1], SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).