Stem-loop sequence mmu-mir-328

Accession MI0000603
Symbol MGI:Mir328
Description Mus musculus miR-328 stem-loop
Gene family MIPF0000203; mir-328
Stem-loop 
cugucuc  ag cu     a         ga     u     a aaa  a 
       gg  c  ggggc ggggggcag  ggggc caggg g   gu u
       ||  |  ||||| |||||||||  ||||| ||||| |   ||  
       cc  g  cccug cuucccguc  ucccg guccc c   ca c
--ugaac  cu uc     c         uc     -     - -ga  u
Get sequence
Deep sequencing
22902 reads, 96 experiments
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000602 ) - its expression was later independently verified in mouse [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 105308364-105308460 [-]
antisense
ENSMUST00000109375 ; Elmo3-201; 3'UTR (exon 14)
Database links

Mature sequence mmu-miR-328-5p

Accession MIMAT0017030
Previous IDs mmu-miR-328*
Sequence

21 -  

ggggggcaggaggggcucaggg

 - 42

Get sequence
Deep sequencing 385 reads, 48 experiments
Evidence experimental; Solexa [5]
Predicted targets

Mature sequence mmu-miR-328-3p

Accession MIMAT0000565
Previous IDs mmu-miR-328
Sequence

61 -  

cuggcccucucugcccuuccgu

 - 82

Get sequence
Deep sequencing 20994 reads, 81 experiments
Evidence experimental; cloned [2-3], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).