Stem-loop sequence rno-mir-328a

AccessionMI0000602 (change log)
Previous IDsrno-mir-328
DescriptionRattus norvegicus miR-328a stem-loop
Gene family MIPF0000203; mir-328
Stem-loop
   ---     -      -------     ga     u     agaaa  au 
5'    ugggg cagggg       ggcag  ggggc caggg     gc  c
      ||||| ||||||       |||||  ||||| |||||     ||  u
3'    acccc gucccc       ccguc  ucccg guccc     cg  a
   uaa     u      ugccuuc     uc     -     -----  ac 
Get sequence
Deep sequencing
18121 reads, 71.8 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 37263199-37263282 [-]
antisense
ENSRNOT00000021362 ; Elmo3-201; intron 13
Clustered miRNAs
< 10kb from rno-mir-328a
rno-mir-328achr19: 37263199-37263282 [-]
rno-mir-6318chr19: 37262625-37262733 [-]
Database links

Mature sequence rno-miR-328a-5p

Accession MIMAT0017029
Previous IDsrno-miR-328a*
Sequence

8 - 

ggggggcaggaggggcuca

 - 26

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-328a-3p

Accession MIMAT0000564
Previous IDsrno-miR-328;rno-miR-328a
Sequence

48 - 

cuggcccucucugcccuuccgu

 - 69

Get sequence
Deep sequencing18111 reads, 39 experiments
Evidence experimental; cloned [1-2], Northern [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).