Stem-loop sequence rno-mir-326

AccessionMI0000599 (change log)
DescriptionRattus norvegicus miR-326 stem-loop
Gene family MIPF0000143; mir-326
Stem-loop
   cuc        g            c       uugu  a     guuau 
5'    aucugucu uggggcuggggg agggccu    ga ggcgg     g
      |||||||| |||||||||||| |||||||    || |||||      
3'    uagacgga gcccugaccucc ucccggg    cu ccgcu     c
   auu        -            u       ---u  -     agacu 
Get sequence
Deep sequencing
6417 reads, 10.5 reads per million, 38 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 164518401-164518495 [+]
sense
ENSRNOT00000043554 ; Arrb1-201; intron 1
Database links

Mature sequence rno-miR-326-5p

Accession MIMAT0017028
Previous IDsrno-miR-326*
Sequence

20 - 

gggggcagggccuuugugaa

 - 39

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-326-3p

Accession MIMAT0000560
Previous IDsrno-miR-326
Sequence

60 - 

ccucugggcccuuccuccagu

 - 80

Get sequence
Deep sequencing6239 reads, 38 experiments
Evidence experimental; cloned [1-2], Northern [1], SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).