|
miRBase |
|
Stem-loop sequence rno-mir-326 |
|||||
| Accession | MI0000599 | ||||
| Description | Rattus norvegicus miR-326 stem-loop | ||||
| Gene family | MIPF0000143; mir-326 | ||||
| Stem-loop |
cuc g c uugu a guuau aucugucu uggggcuggggg agggccu ga ggcgg g |||||||| |||||||||||| ||||||| || ||||| uagacgga gcccugaccucc ucccggg cu ccgcu c auu - u ---u - agacu |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence rno-miR-326-5p |
|
| Accession | MIMAT0017028 |
| Previous IDs | rno-miR-326* |
| Sequence |
20 - gggggcagggccuuugugaa - 39 |
| Evidence | experimental; SOLiD [3] |
| Predicted targets |
|
Mature sequence rno-miR-326-3p |
|
| Accession | MIMAT0000560 |
| Previous IDs | rno-miR-326 |
| Sequence |
60 - ccucugggcccuuccuccagu - 80 |
| Evidence | experimental; cloned [1-2], Northern [1], SOLiD [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|