Stem-loop sequence mmu-mir-326

AccessionMI0000598 (change log)
Symbol MGI:Mir326
DescriptionMus musculus miR-326 stem-loop
Gene family MIPF0000143; mir-326
Stem-loop
   cuc        guu          c       uugu  a     guuau 
5'    aucugucu   gggcuggggg agggccu    ga ggcgg     g
      ||||||||   |||||||||| |||||||    || |||||      
3'    uagacgga   ccugaccucc ucccggg    cu ccgcu     c
   auu        -gc          u       ---u  -     agacu 
Get sequence
Deep sequencing
11242 reads, 71.2 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 99552269-99552363 [+]
sense
OTTMUST00000085875 ; Arrb1-001; intron 1
OTTMUST00000085876 ; Arrb1-002; intron 1
OTTMUST00000085880 ; Arrb1-006; intron 1
OTTMUST00000085878 ; Arrb1-004; intron 1
ENSMUST00000098266 ; Arrb1-001; intron 1
ENSMUST00000032995 ; Arrb1-002; intron 1
ENSMUST00000162404 ; Arrb1-006; intron 1
ENSMUST00000161525 ; Arrb1-004; intron 1
ENSMUST00000179755 ; Arrb1-201; intron 1
Database links

Mature sequence mmu-miR-326-5p

Accession MIMAT0017027
Previous IDsmmu-miR-326*
Sequence

20 - 

gggggcagggccuuugugaaggcg

 - 43

Get sequence
Deep sequencing86 reads, 29 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-326-3p

Accession MIMAT0000559
Previous IDsmmu-miR-326
Sequence

60 - 

ccucugggcccuuccuccagu

 - 80

Get sequence
Deep sequencing11043 reads, 71 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).