Stem-loop sequence mmu-mir-325

AccessionMI0000597 (change log)
Symbol MGI:Mir325
DescriptionMus musculus miR-325 stem-loop
Gene family MIPF0000147; mir-325
Stem-loop
   ----------a              cc   u                uu gug 
5'            uauagugcuugguu  uag aggugcucaguaagug  u   a
              ||||||||||||||  ||| ||||||||||||||||  |    
3'            gugucacgaacuaa  auc uccacgaguuauuugc  a   c
   ggucucggauc              cu   c                uu aua 
Get sequence
Deep sequencing
1011 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 105379082-105379179 [-]
sense
OTTMUST00000043700 ; RP23-316B4.2-004; intron 2
OTTMUST00000043699 ; RP23-316B4.2-003; intron 3
OTTMUST00000043697 ; RP23-316B4.2-001; intron 4
OTTMUST00000043698 ; RP23-316B4.2-002; intron 4
ENSMUST00000130264 ; 5330434G04Rik-004; intron 2
ENSMUST00000150604 ; 5330434G04Rik-003; intron 3
ENSMUST00000142109 ; 5330434G04Rik-002; intron 4
ENSMUST00000136406 ; 5330434G04Rik-001; intron 4
Database links

Mature sequence mmu-miR-325-5p

Accession MIMAT0000558
Previous IDsmmu-miR-325;mmu-miR-325*
Sequence

16 - 

ccuaguaggugcucaguaagugu

 - 38

Get sequence
Deep sequencing219 reads, 16 experiments
Evidence experimental; Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-325-3p

Accession MIMAT0004640
Previous IDsmmu-miR-325
Sequence

54 - 

uuuauugagcaccuccuaucaa

 - 75

Get sequence
Deep sequencing789 reads, 19 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).