Stem-loop sequence rno-mir-325

AccessionMI0000596 (change log)
DescriptionRattus norvegicus miR-325 stem-loop
Gene family MIPF0000147; mir-325
Stem-loop
   ----------a              cc   u                uu gug 
5'            uauagugcuugguu  uag aggugcucaguaagug  u   a
              ||||||||||||||  ||| ||||||||||||||||  |    
3'            gugucacgaacuaa  auc uccacgaguuauuugc  a   c
   ggucucggauc              cu   c                uu aua 
Get sequence
Deep sequencing
2304 reads, 15 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 76334271-76334368 [-]
intergenic
Database links

Mature sequence rno-miR-325-5p

Accession MIMAT0000557
Previous IDsrno-miR-325
Sequence

16 - 

ccuaguaggugcucaguaagugu

 - 38

Get sequence
Deep sequencing1155 reads, 17 experiments
Evidence experimental; cloned [1-2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-325-3p

Accession MIMAT0004639
Sequence

54 - 

uuuauugagcaccuccuaucaa

 - 75

Get sequence
Deep sequencing1149 reads, 18 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).