Stem-loop sequence rno-mir-324

AccessionMI0000594 (change log)
DescriptionRattus norvegicus miR-324 stem-loop
Gene family MIPF0000165; mir-324
Stem-loop
   cu      gc     c   u c   a     u   u  aaag 
5'   gacuau  cuccu gca c ccu gggca ugg gu    c
     ||||||  ||||| ||| | ||| ||||| ||| ||     
3'   cugaug  ggggg cgu g gga cccgu acc ca    u
   --      uu     u   c u   c     c   -  gagg 
Get sequence
Deep sequencing
3040 reads, 2.56 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 56621126-56621208 [+]
sense
ENSRNOT00000053642 ; Mir324-201; exon 1
antisense
ENSRNOT00000024973 ; Acadvl-201; intron 11
Database links

Mature sequence rno-miR-324-5p

Accession MIMAT0000553
Sequence

16 - 

cgcauccccuagggcauuggugu

 - 38

Get sequence
Deep sequencing1661 reads, 39 experiments
Evidence experimental; cloned [1-2,4], Northern [1], SOLiD [5]
Predicted targets

Mature sequence rno-miR-324-3p

Accession MIMAT0000554
Sequence

51 - 

ccacugccccaggugcugcugg

 - 72

Get sequence
Deep sequencing1371 reads, 39 experiments
Evidence experimental; cloned [1,3], Northern [1,3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).