Stem-loop sequence rno-mir-301a

AccessionMI0000593 (change log)
Previous IDsrno-mir-301
DescriptionRattus norvegicus miR-301a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ccugc    ua     ga  ac    c    ---u          ----a       
5'      uggc  cugcu  cg  ugcu ugac    uuauugcacu     cuguac 
        ||||  |||||  ||  |||| ||||    ||||||||||     ||||| u
3'      aucg  gacga  gc  acga acug    gauaacguga     gacaug 
   ----c    --     gg  cu    a    uuau          cgauc       
Get sequence
Deep sequencing
22839 reads, 182 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has an independently verified homologue in mouse (MI0000401). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 74417746-74417845 [+]
sense
ENSRNOT00000036098 ; Ska2-201; intron 1
Database links

Mature sequence rno-miR-301a-5p

Accession MIMAT0017026
Previous IDsrno-miR-301a*
Sequence

24 - 

gcucugacuuuauugcacuac

 - 44

Get sequence
Deep sequencing62 reads, 19 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-301a-3p

Accession MIMAT0000552
Previous IDsrno-miR-301;rno-miR-301a
Sequence

61 - 

cagugcaauaguauugucaaagc

 - 83

Get sequence
Deep sequencing22737 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).