Stem-loop sequence mmu-mir-322

AccessionMI0000590 (change log)
Symbol MGI:Mir322
DescriptionMus musculus miR-322 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
   ccucguuga   -       c  ca     aa             g auu 
5'          cuc cgaaggg ug  gcagc  uucauguuuugga u   g
            ||| ||||||| ||  |||||  ||||||||||||| |    
3'          ggg gcuuccc ac  cgucg  aaguacaaaacuu g   c
   ------aag   u       c  aa     cg             g aac 
Get sequence
Deep sequencing
390066 reads, 4.09e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mir-322 locus appears able to express two mature miRNA sequences. Poy et al. cloned a sequence originating from the 5' arm from mouse pancreatic beta cells [2]. This sequence is orthologous to the experimentally validated miR-424 sequence from human (MI0001446), but was named miR-322-5p in [2]. The mature product from the 3' arm of this precursor sequence is the predicted mouse homologue of miR-322, experimentally verified in rat (MI0000589) [1], and later in mouse [3]. The orthologous human locus does not appear to contain the miR-322 sequence. Landgraf et al. confirm that the 5' product is the predominant one [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 53054255-53054349 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-322
mmu-mir-322chrX: 53054255-53054349 [-]
mmu-mir-503chrX: 53053984-53054054 [-]
mmu-mir-351chrX: 53053255-53053353 [-]
mmu-mir-542chrX: 53049403-53049487 [-]
mmu-mir-450a-2chrX: 53048299-53048367 [-]
mmu-mir-450a-1chrX: 53048154-53048244 [-]
mmu-mir-450bchrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-322-5p

Accession MIMAT0000548
Previous IDsmmu-miR-322-5p;mmu-miR-424;mmu-miR-322
Sequence

23 - 

cagcagcaauucauguuuugga

 - 44

Get sequence
Deep sequencing275405 reads, 76 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-322-3p

Accession MIMAT0000549
Previous IDsmmu-miR-322-3p;mmu-miR-322;mmu-miR-322*
Sequence

61 - 

aaacaugaagcgcugcaacac

 - 81

Get sequence
Deep sequencing114610 reads, 76 experiments
Evidence experimental; cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).