Stem-loop sequence rno-mir-322-1

AccessionMI0000589 (change log)
Previous IDsrno-mir-322
DescriptionRattus norvegicus miR-322-1 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
   ccucgcuga   -       a  ca     aa             g auu 
5'          cuc cgaaggg ug  gcagc  uucauguuuugga u   g
            ||| ||||||| ||  |||||  ||||||||||||| |    
3'          ggg gcuuccc ac  cgucg  aaguacaaaacuu g   c
   ------aaa   u       c  aa     cg             g aac 
Get sequence
Deep sequencing
33129 reads, 269 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158148161-158148255 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-322-1
rno-mir-322-1chrX: 158148161-158148255 [+]
rno-mir-503-1chrX: 158148476-158148546 [+]
rno-mir-351-1chrX: 158149206-158149286 [+]
rno-mir-542-1chrX: 158152146-158152224 [+]
rno-mir-450b-1chrX: 158153254-158153322 [+]
rno-mir-450achrX: 158153377-158153467 [+]
Database links

Mature sequence rno-miR-322-5p

Accession MIMAT0001619
Previous IDsrno-miR-424;rno-miR-322
Sequence

23 - 

cagcagcaauucauguuuugga

 - 44

Get sequence
Deep sequencing51574 reads, 39 experiments
Evidence experimental; cloned [2-3], SOLiD [4]

Mature sequence rno-miR-322-3p

Accession MIMAT0000547
Previous IDsrno-miR-322;rno-miR-322*
Sequence

61 - 

aaacaugaagcgcugcaaca

 - 80

Get sequence
Deep sequencing14682 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [4]

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).