|
miRBase |
|
Stem-loop sequence MI0000588 |
|||||
| Accession | MI0000588 | ||||
| ID | mmu-mir-103-2 | ||||
| Symbol | MGI:Mir103-2 | ||||
| Description | Mus musculus miR-103-2 stem-loop | ||||
| Stem-loop |
g c g -- u u ---- ua ucuu gu cuuuca gcu cu uacagugcugc cuug g |||| || |||||| ||| || ||||||||||| |||| c agaa ca gaaagu cgg ga auguuacgacg ggac a a c a au - c aacu uu |
||||
| Comments |
This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3]. |
||||
| Genome context |
View flanking features |
||||
| Database links | |||||
| Gene family |
MIPF0000024; mir-103 |
||||
Mature sequence MIMAT0000546 |
|
| Accession | MIMAT0000546 |
| ID | mmu-miR-103 |
| Sequence |
52 - agcagcauuguacagggcuauga - 74 |
| Evidence | experimental; cloned [2-4], Solexa [5] |
| Predicted targets |
|
References |
|
| 1 |
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 2 |
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
| 3 | |
| 4 |
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. [Epub prior to print](2010).
|