Stem-loop sequence mmu-mir-103-2

AccessionMI0000588 (change log)
Symbol MGI:Mir103-2
DescriptionMus musculus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

97 open access papers mention mmu-mir-103-2
(429 sentences)

Stem-loop
   g    c  g      --   u  u           ----    ua 
5'  ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
    |||| || ||||||  ||| || |||||||||||    ||||  c
3'  agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
   a    c  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
6980794 reads, 1.72e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 131288052-131288137 [+]
sense
OTTMUST00000038277 ; Pank2-007; intron 2
OTTMUST00000038276 ; Pank2-006; intron 2
OTTMUST00000038274 ; Pank2-004; intron 3
OTTMUST00000038278 ; Pank2-008; intron 3
OTTMUST00000038271 ; Pank2-001; intron 5
OTTMUST00000038273 ; Pank2-003; intron 5
OTTMUST00000038275 ; Pank2-005; intron 7
ENSMUST00000145904 ; Pank2-007; intron 2
ENSMUST00000183388 ; Pank2-006; intron 2
ENSMUST00000184932 ; Pank2-004; intron 3
ENSMUST00000183349 ; Pank2-008; intron 3
ENSMUST00000150843 ; Pank2-001; intron 5
ENSMUST00000184105 ; Pank2-003; intron 5
ENSMUST00000138509 ; Pank2-005; intron 7
Database links

Mature sequence mmu-miR-103-2-5p

Accession MIMAT0017025
Previous IDsmmu-miR-103-2*
Sequence

15 - 

agcuucuuuacagugcugccuug

 - 37

Get sequence
Deep sequencing1049 reads, 86 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-103-3p

Accession MIMAT0000546
Previous IDsmmu-miR-103
Sequence

52 - 

agcagcauuguacagggcuauga

 - 74

Get sequence
Deep sequencing13957755 reads, 107 experiments
Evidence experimental; cloned [2-4], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).