Stem-loop sequence mmu-mir-103-2

Accession

MI0000588

Symbol

MGI:Mir103-2

Description

Mus musculus miR-103-2 stem-loop

Gene family

MIPF0000024; mir-103

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Stem-loop

g    c  g      --   u  u           ----    ua 
 ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
 |||| || ||||||  ||| || |||||||||||    ||||  c
 agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
a    c  a      au   -  c           aacu    uu 

Deep sequencing

7755745 reads, 97 experiments

Comments

This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3].

Genome context

• Coordinates (GRCm38): chr2: 131288052-131288137 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000038277 ; Pank2-007; intron 2

  OTTMUST00000038276 ; Pank2-006; intron 2

  OTTMUST00000038278 ; Pank2-008; intron 3

  OTTMUST00000038274 ; Pank2-004; intron 3

  OTTMUST00000038273 ; Pank2-003; intron 5

  OTTMUST00000038271 ; Pank2-001; intron 5

  OTTMUST00000038275 ; Pank2-005; intron 7

  ENSMUST00000128950 ; Pank2-006; intron 2

  ENSMUST00000145904 ; Pank2-007; intron 2

  ENSMUST00000135679 ; Pank2-008; intron 3

  ENSMUST00000148231 ; Pank2-004; intron 3

  ENSMUST00000103185 ; Pank2-003; intron 5

  ENSMUST00000150843 ; Pank2-001; intron 5

  ENSMUST00000138509 ; Pank2-005; intron 7

Database links

• ENTREZGENE: 723825;Mir103-2
• MGI: 3619059;Mir103-2

Mature sequence mmu-miR-103-2-5p

• Accession: MIMAT0017025
• Previous IDs: mmu-miR-103-2*
• Sequence: 15 - agcuucuuuacagugcugccuug - 37
• Deep sequencing: 971 reads, 68 experiments
• Evidence: experimental; 454 [6], Solexa [7]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-103-2-5p
  • MIRDB:mmu-miR-103-2-5p
  • RNA22-MMU:mmu-miR-103-2-5p

Mature sequence mmu-miR-103-3p

• Accession: MIMAT0000546
• Previous IDs: mmu-miR-103
• Sequence: 52 - agcagcauuguacagggcuauga - 74
• Deep sequencing: 11824393 reads, 82 experiments
• Evidence: experimental; cloned [2-4], Solexa [5,7]
• Validated targets:
  • TARBASE:mmu-miR-103-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-103-3p
  • MICRORNA.ORG:mmu-miR-103-3p
  • MIRDB:mmu-miR-103-3p
  • RNA22-MMU:mmu-miR-103-3p
  • TARGETSCAN-VERT:mmu-miR-103

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).