Stem-loop sequence mmu-mir-103-2

Accession MI0000588
Symbol MGI:Mir103-2
Description Mus musculus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g    c  g      --   u  u           ----    ua 
 ucuu gu cuuuca  gcu cu uacagugcugc    cuug  g
 |||| || ||||||  ||| || |||||||||||    ||||  c
 agaa ca gaaagu  cgg ga auguuacgacg    ggac  a
a    c  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
7755745 reads, 97 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 131288052-131288137 [+]
sense
OTTMUST00000038277 ; Pank2-007; intron 2
OTTMUST00000038276 ; Pank2-006; intron 2
OTTMUST00000038278 ; Pank2-008; intron 3
OTTMUST00000038274 ; Pank2-004; intron 3
OTTMUST00000038273 ; Pank2-003; intron 5
OTTMUST00000038271 ; Pank2-001; intron 5
OTTMUST00000038275 ; Pank2-005; intron 7
ENSMUST00000128950 ; Pank2-006; intron 2
ENSMUST00000145904 ; Pank2-007; intron 2
ENSMUST00000135679 ; Pank2-008; intron 3
ENSMUST00000148231 ; Pank2-004; intron 3
ENSMUST00000103185 ; Pank2-003; intron 5
ENSMUST00000150843 ; Pank2-001; intron 5
ENSMUST00000138509 ; Pank2-005; intron 7
Database links

Mature sequence mmu-miR-103-2-5p

Accession MIMAT0017025
Previous IDs mmu-miR-103-2*
Sequence

15 - 

agcuucuuuacagugcugccuug

 - 37

Get sequence
Deep sequencing 971 reads, 68 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

Mature sequence mmu-miR-103-3p

Accession MIMAT0000546
Previous IDs mmu-miR-103
Sequence

52 - 

agcagcauuguacagggcuauga

 - 74

Get sequence
Deep sequencing 11824393 reads, 82 experiments
Evidence experimental; cloned [2-4], Solexa [5,7]
Validated targets
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).