miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000587

Accession MI0000587
ID mmu-mir-103-1
Symbol MGI:Mir103-1
Description Mus musculus miR-103-1 stem-loop
Stem-loop 
u     c    c  --    u  u           c   u g a 
 ucuua ugcc uc  ggcu cu uacagugcugc uug u c u
 ||||| |||| ||  |||| || ||||||||||| ||| | |  
 agagu acgg ag  ucgg ga auguuacgacg aac a g a
c     u    a  ua    -  c           -   u g u
Get sequence
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2-4].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
11: 35595898-35595983 [+]
sense
OTTMUST00000012065 ; Pank3-001; intron 5
ENSMUST00000018990 ; Pank3-001; intron 5

View flanking features
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0000546

Accession MIMAT0000546
ID mmu-miR-103
Sequence

52 -  

agcagcauuguacagggcuauga

 - 74

Get sequence
Evidence experimental; cloned [2-4]
Predicted targets

References

1
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
"Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).