Stem-loop sequence mmu-mir-98

AccessionMI0000586 (change log)
Symbol MGI:Mir98
DescriptionMus musculus miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

61 open access papers mention mmu-mir-98
(614 sentences)

Stem-loop
   c   -      ug   u                 u    ---------      aggg 
5'  ugc acaugc  ggg gagguaguaaguuguau guug         uggggu    a
    ||| ||||||  ||| ||||||||||||||||| ||||         ||||||    u
3'  acg ugugug  ucc uuucaucauucaacaua caau         accccg    u
   u   g      gu   -                 u    agaagaaug      gauu 
Get sequence
Deep sequencing
48181330 reads, 9.19e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 151913214-151913321 [+]
sense
OTTMUST00000046396 ; Huwe1-001; intron 57
OTTMUST00000046226 ; Huwe1-002; intron 59
ENSMUST00000112622 ; Huwe1-001; intron 57
ENSMUST00000026292 ; Huwe1-002; intron 59
Clustered miRNAs
< 10kb from mmu-mir-98
mmu-let-7f-2chrX: 151912346-151912428 [+]
mmu-mir-98chrX: 151913214-151913321 [+]
Database links

Mature sequence mmu-miR-98-5p

Accession MIMAT0000545
Previous IDsmmu-miR-98
Sequence

16 - 

ugagguaguaaguuguauuguu

 - 37

Get sequence
Deep sequencing48179912 reads, 107 experiments
Evidence experimental; cloned [1], Illumina [2,4]
Database links
Predicted targets

Mature sequence mmu-miR-98-3p

Accession MIMAT0017023
Previous IDsmmu-miR-98*
Sequence

74 - 

cuauacaacuuacuacuuuccu

 - 95

Get sequence
Deep sequencing1386 reads, 75 experiments
Evidence experimental; 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).