Stem-loop sequence mmu-mir-129-2

AccessionMI0000585 (change log)
Symbol MGI:Mir129-2
DescriptionMus musculus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Literature search

58 open access papers mention mmu-mir-129-2
(610 sentences)

Stem-loop
   u             -       c   cu      ---     acau 
5'  gccuuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
3'  cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
   g             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
209520 reads, 209 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The miRNA from the 5' arm of this precursor was verified by cloning in mouse [1]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both mouse (this entry and MI0000222) and human (MI0000252 and MI0000473). Poy et al. independently cloned a mature miRNA from the 3' arm of the precursor, called mmu-miR-129-3p [3]. This sequence is not perfectly conserved in the other predicted mouse miR-129 precursor (MI0000222). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 94241364-94241453 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-129-2
mmu-mir-129bchr2: 94241378-94241442 [+]
mmu-mir-129-2chr2: 94241364-94241453 [-]
Database links

Mature sequence mmu-miR-129-5p

Accession MIMAT0000209
Previous IDsmmu-miR-129
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Deep sequencing325625 reads, 97 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-129-2-3p

Accession MIMAT0000544
Previous IDsmmu-miR-129-3p
Sequence

57 - 

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Deep sequencing46493 reads, 96 experiments
Evidence experimental; cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).