Stem-loop sequence mmu-mir-129-2

Accession MI0000585
Symbol MGI:Mir129-2
Description Mus musculus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u             -       c   cu      ---     acau 
 gccuuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
 ||||||||||||| ||||||| |||  ||||||   |||||     
 cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
g             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
69285 reads, 94 experiments
Comments

The miRNA from the 5' arm of this precursor was verified by cloning in mouse [1]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both mouse (this entry and MI0000222 ) and human (MI0000252 and MI0000473 ). Poy et al. independently cloned a mature miRNA from the 3' arm of the precursor, called mmu-miR-129-3p [3]. This sequence is not perfectly conserved in the other predicted mouse miR-129 precursor (MI0000222 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 94241364-94241453 [-]
intergenic
Database links

Mature sequence mmu-miR-129-5p

Accession MIMAT0000209
Previous IDs mmu-miR-129
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Deep sequencing 51874 reads, 76 experiments
Evidence experimental; cloned [1,3-4], Solexa [5-6]
Predicted targets

Mature sequence mmu-miR-129-2-3p

Accession MIMAT0000544
Previous IDs mmu-miR-129-3p
Sequence

57 - 

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Deep sequencing 42019 reads, 73 experiments
Evidence experimental; cloned [3-4], Solexa [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).