Stem-loop sequence mmu-mir-34a

Accession MI0000584
Previous IDs mmu-mir-172;mmu-mir-34c
Symbol MGI:Mir34a
Description Mus musculus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   c    -    a    uu        -   a          --gug   a 
 cag ugug agua uucu  ggcagugu cuu gcugguuguu     agu u
 ||| |||| |||| ||||  |||||||| ||| ||||||||||     |||  
 guu acac ucgu aaga  ccgucaua gaa cgacuaacga     ucg u
u   -    g    g    uc        u   -          aggaa   a 
Get sequence
Deep sequencing
53850 reads, 95 experiments
Comments

Houbaviy et al. cloned this miRNA from embryonic stem cells and named it miR-172 [1]. This sequence is homologous to human miR-34a (MI0000268 ), and so is renamed miR-34a here. This sequence is not related to miR172 from plants (MI0000215 and MI0000216 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 150068454-150068555 [+]
intergenic
Database links

Mature sequence mmu-miR-34a-5p

Accession MIMAT0000542
Previous IDs mmu-miR-34a
Sequence

20 - 

uggcagugucuuagcugguugu

 - 41

Get sequence
Deep sequencing 27003 reads, 80 experiments
Evidence experimental; cloned [1,3], Solexa [4,6]
Validated targets
Predicted targets

Mature sequence mmu-miR-34a-3p

Accession MIMAT0017022
Previous IDs mmu-miR-34a*
Sequence

64 - 

aaucagcaaguauacugcccu

 - 84

Get sequence
Deep sequencing 1675 reads, 63 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).