Stem-loop sequence mmu-mir-96

AccessionMI0000583 (change log)
Symbol MGI:Mir96
DescriptionMus musculus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

104 open access papers mention mmu-mir-96
(894 sentences)

Stem-loop
   c     cca       gg  g  u         g     uu     ug -  cu 
5'  cagua   ucugcuu  cc au uuggcacua cacau  uugcu  u gu  c
    |||||   |||||||  || || ||||||||| |||||  |||||  | ||   
3'  gucgu   gggcgaa  gg ua aaccgugau gugua  aacga  g cg  u
   c     --c       aa  g  u         -     cu     gu u  cc 
Get sequence
Deep sequencing
55515 reads, 211 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 30169446-30169551 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-96
mmu-mir-183chr6: 30169668-30169737 [-]
mmu-mir-96chr6: 30169446-30169551 [-]
mmu-mir-182chr6: 30165918-30165992 [-]
Database links

Mature sequence mmu-miR-96-5p

Accession MIMAT0000541
Previous IDsmmu-miR-96
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Deep sequencing55278 reads, 95 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4,6]
Database links
Predicted targets

Mature sequence mmu-miR-96-3p

Accession MIMAT0017021
Previous IDsmmu-miR-96*
Sequence

66 - 

caaucauguguagugccaauau

 - 87

Get sequence
Deep sequencing122 reads, 32 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).