Stem-loop sequence mmu-mir-93

AccessionMI0000581 (change log)
Symbol MGI:Mir93
DescriptionMus musculus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

104 open access papers mention mmu-mir-93
(1041 sentences)

Stem-loop
   a   a         -ca       -     u    g   u  aau 
5'  guc ugggggcuc   aagugcu guucg gcag uag gu   u
    ||| |||||||||   ||||||| ||||| |||| ||| ||   a
3'  cag acccccgag   uucacga cgagu cguc auc ca   c
   a   g         ccc       u     -    -   -  guc 
Get sequence
Deep sequencing
589996 reads, 2.02e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 138165523-138165610 [-]
sense
OTTMUST00000054336 ; Mcm7-010; exon 1
OTTMUST00000054328 ; Mcm7-002; intron 8
OTTMUST00000054327 ; Mcm7-001; intron 13
ENSMUST00000125316 ; Mcm7-010; exon 1
ENSMUST00000148879 ; Mcm7-002; intron 8
ENSMUST00000000505 ; Mcm7-001; intron 13
Clustered miRNAs
< 10kb from mmu-mir-93
mmu-mir-106bchr5: 138165737-138165818 [-]
mmu-mir-93chr5: 138165523-138165610 [-]
mmu-mir-25chr5: 138165321-138165404 [-]
Database links

Mature sequence mmu-miR-93-5p

Accession MIMAT0000540
Previous IDsmmu-miR-93
Sequence

15 - 

caaagugcuguucgugcagguag

 - 37

Get sequence
Deep sequencing584962 reads, 107 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-93-3p

Accession MIMAT0004636
Previous IDsmmu-miR-93*
Sequence

54 - 

acugcugagcuagcacuucccg

 - 75

Get sequence
Deep sequencing4879 reads, 106 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).