Stem-loop sequence mmu-mir-92a-2

AccessionMI0000580 (change log)
Previous IDsmmu-mir-92;mmu-mir-92-2
DescriptionMus musculus miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

131 open access papers mention mmu-mir-92a-2
(818 sentences)

Stem-loop
   u    --a   a   a     g     u    g  u     -      
5'  gccc   uuc ucc caggu gggau ggug ca uacuu guguu 
    ||||   ||| ||| ||||| ||||| |||| || ||||| |||| a
3'  uggg   aag agg guccg cccug ucac gu augaa uauag 
   u    aga   a   a     g     u    -  u     a      
Get sequence
Deep sequencing
5071475 reads, 1.12e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52741838-52741928 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-92a-2
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-92a-2-5p

Accession MIMAT0004635
Previous IDsmmu-miR-92a*;mmu-miR-92a-2*
Sequence

16 - 

agguggggauugguggcauuac

 - 37

Get sequence
Deep sequencing11069 reads, 42 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-92a-3p

Accession MIMAT0000539
Previous IDsmmu-miR-92;mmu-miR-92a
Sequence

55 - 

uauugcacuugucccggccug

 - 75

Get sequence
Deep sequencing10803467 reads, 107 experiments
Evidence experimental; cloned [1,3-4], Northern [1], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).