Stem-loop sequence mmu-mir-31

AccessionMI0000579 (change log)
Symbol MGI:Mir31
DescriptionMus musculus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

143 open access papers mention mmu-mir-31
(1142 sentences)

Stem-loop
   u   c   uaac     acu      ga     g   c         -u   gaa 
5'  gcu cug    ucgga   ggagag  ggcaa aug uggcauagc  guu   c
    ||| |||    |||||   ||||||  ||||| ||| |||||||||  |||    
3'  cga gac    agucu   ccuuuc  ccguu uac accguaucg  caa   u
   u   c   ----     -gu      ua     a   a         uc   gag 
Get sequence
Deep sequencing
139730 reads, 389 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 88910557-88910662 [-]
intergenic
Database links

Mature sequence mmu-miR-31-5p

Accession MIMAT0000538
Previous IDsmmu-miR-31
Sequence

28 - 

aggcaagaugcuggcauagcug

 - 49

Get sequence
Deep sequencing137818 reads, 105 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-31-3p

Accession MIMAT0004634
Previous IDsmmu-miR-31*
Sequence

64 - 

ugcuaugccaacauauugccauc

 - 86

Get sequence
Deep sequencing1793 reads, 68 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).