Stem-loop sequence mmu-mir-31

Accession MI0000579
Symbol MGI:Mir31
Description Mus musculus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   c   uaac     acu      ga     g   c         -u   gaa 
 gcu cug    ucgga   ggagag  ggcaa aug uggcauagc  guu   c
 ||| |||    |||||   ||||||  ||||| ||| |||||||||  |||    
 cga gac    agucu   ccuuuc  ccguu uac accguaucg  caa   u
u   c   ----     -gu      ua     a   a         uc   gag 
Get sequence
Deep sequencing
132746 reads, 90 experiments
Comments

This sequence maps to mouse chromosome 4.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 88910557-88910662 [-]
intergenic
Database links

Mature sequence mmu-miR-31-5p

Accession MIMAT0000538
Previous IDs mmu-miR-31
Sequence

28 - 

aggcaagaugcuggcauagcug

 - 49

Get sequence
Deep sequencing 122540 reads, 75 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-31-3p

Accession MIMAT0004634
Previous IDs mmu-miR-31*
Sequence

64 - 

ugcuaugccaacauauugccauc

 - 86

Get sequence
Deep sequencing 753 reads, 45 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).