Stem-loop sequence mmu-mir-27a

AccessionMI0000578
Symbol MGI:Mir27a
DescriptionMus musculus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u  -  u a  a  a         ug  u       a  uccac 
5'  gg cc g gg gc gggcuuagc  cu gugagca gg     a
    || || | || || |||||||||  || ||||||| ||      
3'  cc gg c cc cg cuugaaucg  ga cacuugu cu     g
   c  a  u -  c  c         gu  -       g  gaaac 
Get sequence
Deep sequencing
1238659 reads, 7.71e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 84208672-84208758 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-27a
mmu-mir-23achr8: 84208518-84208592 [+]
mmu-mir-27achr8: 84208672-84208758 [+]
mmu-mir-24-2chr8: 84208815-84208921 [+]
mmu-mir-3074-2chr8: 84208825-84208907 [-]
Database links

Mature sequence mmu-miR-27a-5p

Accession MIMAT0004633
Previous IDsmmu-miR-27a*
Sequence

14 - 

agggcuuagcugcuugugagca

 - 35

Get sequence
Deep sequencing2765 reads, 82 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

Mature sequence mmu-miR-27a-3p

Accession MIMAT0000537
Previous IDsmmu-miR-27a
Sequence

56 - 

uucacaguggcuaaguuccgc

 - 76

Get sequence
Deep sequencing523307 reads, 90 experiments
Evidence experimental; cloned [1-2,4-5], Northern [1], Illumina [6]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).