Stem-loop sequence mmu-mir-29c

Accession MI0000577
Symbol MGI:Mir29c
Description Mus musculus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a         -  ggc           ucc       ---     u 
 ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
 ||||||||| ||   |||||||||||   |||||||   ||||| u
 gggggaugu gu   auuggcuaaag   accacga   guuuu g
a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
3228717 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 195037547-195037634 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-29c
mmu-mir-29b-2 chr1: 195037040-195037120 [+]
mmu-mir-29c chr1: 195037547-195037634 [+]
Database links

Mature sequence mmu-miR-29c-5p

Accession MIMAT0004632
Previous IDs mmu-miR-29c*
Sequence

16 - 

ugaccgauuucuccugguguuc

 - 37

Get sequence
Deep sequencing 2262 reads, 74 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-29c-3p

Accession MIMAT0000536
Previous IDs mmu-miR-29c
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing 3039319 reads, 82 experiments
Evidence experimental; cloned [1-3], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).