Stem-loop sequence mmu-mir-29a

Accession MI0000576
Symbol MGI:Mir29a
Description Mus musculus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a    uuagagg            uuu       c    ucaa 
 cccc       augacugauuuc   ugguguu agag    u
 ||||       ||||||||||||   ||||||| ||||    a
 gggg       uauuggcuaaag   accacga ucuu    g
a    uuaguaa            ucu       -    uuaa 
Get sequence
Deep sequencing
3232327 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 31062660-31062747 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-29a
mmu-mir-29b-1 chr6: 31063023-31063093 [-]
mmu-mir-29a chr6: 31062660-31062747 [-]
Database links

Mature sequence mmu-miR-29a-5p

Accession MIMAT0004631
Previous IDs mmu-miR-29a*
Sequence

16 - 

acugauuucuuuugguguucag

 - 37

Get sequence
Deep sequencing 5104 reads, 79 experiments
Evidence experimental; cloned [5], Solexa [6-7]
Predicted targets

Mature sequence mmu-miR-29a-3p

Accession MIMAT0000535
Previous IDs mmu-miR-29a
Sequence

54 - 

uagcaccaucugaaaucgguua

 - 75

Get sequence
Deep sequencing 3043595 reads, 82 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Solexa [6-7]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).