Stem-loop sequence mmu-mir-29a

AccessionMI0000576 (change log)
Symbol MGI:Mir29a
DescriptionMus musculus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

329 open access papers mention mmu-mir-29a
(2785 sentences)

Stem-loop
   a    uuagagg            uuu       c    ucaa 
5'  cccc       augacugauuuc   ugguguu agag    u
    ||||       ||||||||||||   ||||||| ||||    a
3'  gggg       uauuggcuaaag   accacga ucuu    g
   a    uuaguaa            ucu       -    uuaa 
Get sequence
Deep sequencing
4312419 reads, 1.49e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 31062660-31062747 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-29a
mmu-mir-29b-1chr6: 31063023-31063093 [-]
mmu-mir-29achr6: 31062660-31062747 [-]
Database links

Mature sequence mmu-miR-29a-5p

Accession MIMAT0004631
Previous IDsmmu-miR-29a*
Sequence

16 - 

acugauuucuuuugguguucag

 - 37

Get sequence
Deep sequencing10900 reads, 98 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-29a-3p

Accession MIMAT0000535
Previous IDsmmu-miR-29a
Sequence

54 - 

uagcaccaucugaaaucgguua

 - 75

Get sequence
Deep sequencing4301508 reads, 108 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).