Stem-loop sequence mmu-mir-26b

AccessionMI0000575 (change log)
Symbol MGI:Mir26b
DescriptionMus musculus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

102 open access papers mention mmu-mir-26b
(533 sentences)

Stem-loop
   u  -    ga   -   u        uc         ug    g 
5'  gc ccgg  ccc agu caaguaau  aggauaggu  uggu c
    || ||||  ||| ||| ||||||||  |||||||||  ||||  
3'  cg ggcc  ggg ucg guucauua  ucuuguccg  acca u
   c  u    gg   c   -        cc         --    g 
Get sequence
Deep sequencing
4034273 reads, 1.16e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 74394310-74394394 [+]
sense
OTTMUST00000051578 ; Ctdsp1-002; intron 3
OTTMUST00000051577 ; Ctdsp1-001; intron 4
ENSMUST00000141175 ; Ctdsp1-002; intron 3
ENSMUST00000027367 ; Ctdsp1-001; intron 4
Database links

Mature sequence mmu-miR-26b-5p

Accession MIMAT0000534
Previous IDsmmu-miR-26b
Sequence

15 - 

uucaaguaauucaggauaggu

 - 35

Get sequence
Deep sequencing4031855 reads, 107 experiments
Evidence experimental; cloned [1-2,4-6], Northern [2], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-26b-3p

Accession MIMAT0004630
Previous IDsmmu-miR-26b*
Sequence

51 - 

ccuguucuccauuacuuggcuc

 - 72

Get sequence
Deep sequencing2413 reads, 83 experiments
Evidence experimental; cloned [6], Illumina [7-8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).