Stem-loop sequence mmu-mir-24-2

AccessionMI0000572 (change log)
Symbol MGI:Mir24-2
DescriptionMus musculus miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

142 open access papers mention mmu-mir-24-2
(1230 sentences)

Stem-loop
   -   ucu    ----     ccgc    c  g   a         aa    ug  u 
5'  gcc   cucc    gggcu    cucc gu ccu cugagcuga  cagu  au c
    |||   ||||    |||||    |||| || ||| |||||||||  ||||  ||  
3'  cgg   gagg    cccga    gagg ca gga gacuugacu  guca  ug c
   a   -uc    aucc     -ccu    a  a   c         cg    cg  a 
Get sequence
Deep sequencing
2368751 reads, 1.11e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 84208815-84208921 [+]
sense
OTTMUST00000112758 ; RP24-64D24.4-001; exon 1
ENSMUST00000180630 ; Gm26532-001; exon 1
Clustered miRNAs
< 10kb from mmu-mir-24-2
mmu-mir-23achr8: 84208518-84208592 [+]
mmu-mir-27achr8: 84208672-84208758 [+]
mmu-mir-24-2chr8: 84208815-84208921 [+]
mmu-mir-3074-2chr8: 84208825-84208907 [-]
Database links

Mature sequence mmu-miR-24-2-5p

Accession MIMAT0005440
Previous IDsmmu-miR-24-2*
Sequence

25 - 

gugccuacugagcugaaacagu

 - 46

Get sequence
Deep sequencing39505 reads, 106 experiments
Evidence experimental; cloned [6], Illumina [7-8]
Database links
Predicted targets

Mature sequence mmu-miR-24-3p

Accession MIMAT0000219
Previous IDsmmu-miR-24
Sequence

61 - 

uggcucaguucagcaggaacag

 - 82

Get sequence
Deep sequencing4657101 reads, 107 experiments
Evidence experimental; cloned [1-2,4-6], Northern [2], Illumina [7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).