Stem-loop sequence mmu-mir-23a

AccessionMI0000571
Symbol MGI:Mir23a
DescriptionMus musculus miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   c  a   c     -       g    g      a  c 
5'  gg cgg ugggg uuccugg gaug gauuug ug c
    || ||| ||||| ||||||| |||| |||||| || a
3'  cc guc accuu agggacc uuac cuaaac ac g
   c  a   a     u       g    a      -  u 
Get sequence
Deep sequencing
850666 reads, 3.45e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 84208518-84208592 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-23a
mmu-mir-23achr8: 84208518-84208592 [+]
mmu-mir-27achr8: 84208672-84208758 [+]
mmu-mir-24-2chr8: 84208815-84208921 [+]
mmu-mir-3074-2chr8: 84208825-84208907 [-]
Database links

Mature sequence mmu-miR-23a-5p

Accession MIMAT0017019
Previous IDsmmu-miR-23a*
Sequence

10 - 

gggguuccuggggaugggauuu

 - 31

Get sequence
Deep sequencing2424 reads, 67 experiments
Evidence experimental; 454 [5], Illumina [6]
Predicted targets

Mature sequence mmu-miR-23a-3p

Accession MIMAT0000532
Previous IDsmmu-miR-23a
Sequence

46 - 

aucacauugccagggauuucc

 - 66

Get sequence
Deep sequencing522610 reads, 90 experiments
Evidence experimental; cloned [1-3], Illumina [4,6]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).