Stem-loop sequence mmu-mir-23a

Accession

MI0000571

Symbol

MGI:Mir23a

Description

Mus musculus miR-23a stem-loop

Gene family

MIPF0000027; mir-23

Stem-loop

c  a   c     -       g    g      a  c 
 gg cgg ugggg uuccugg gaug gauuug ug c
 || ||| ||||| ||||||| |||| |||||| || a
 cc guc accuu agggacc uuac cuaaac ac g
c  a   a     u       g    a      -  u 

Deep sequencing

805955 reads, 97 experiments

Genome context

• Coordinates (GRCm38): chr8: 84208518-84208592 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-23a

• mmu-mir-23a: chr8: 84208518-84208592 [+]
• mmu-mir-27a: chr8: 84208672-84208758 [+]
• mmu-mir-24-2: chr8: 84208815-84208921 [+]
• mmu-mir-3074-2: chr8: 84208825-84208907 [-]

Database links

• EMBL: AJ459713;MMU459713
• ENTREZGENE: 387216;Mir23a
• MGI: 2676897;Mir23a

Mature sequence mmu-miR-23a-5p

• Accession: MIMAT0017019
• Previous IDs: mmu-miR-23a*
• Sequence: 10 - gggguuccuggggaugggauuu - 31
• Deep sequencing: 2315 reads, 65 experiments
• Evidence: experimental; 454 [5], Solexa [6]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-23a-5p
  • MIRDB:mmu-miR-23a-5p
  • RNA22-MMU:mmu-miR-23a-5p

Mature sequence mmu-miR-23a-3p

• Accession: MIMAT0000532
• Previous IDs: mmu-miR-23a
• Sequence: 46 - aucacauugccagggauuucc - 66
• Deep sequencing: 748368 reads, 82 experiments
• Evidence: experimental; cloned [1-3], Solexa [4,6]
• Validated targets:
  • TARBASE:mmu-miR-23a-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-23a-3p
  • MICRORNA.ORG:mmu-miR-23a-3p
  • MIRDB:mmu-miR-23a-3p
  • RNA22-MMU:mmu-miR-23a-3p
  • TARGETSCAN-VERT:mmu-miR-23a

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).