Stem-loop sequence mmu-mir-22

Accession MI0000570
Symbol MGI:Mir22
Description Mus musculus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a  --u   u   cc               -     a      u  ccu 
 cc   ggc gag  gcaguaguucuucag uggca gcuuua gu   g
 ||   ||| |||  ||||||||||||||| ||||| |||||| ||   a
 gg   ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
c  ucc   u   -c               g     -      -  acc 
Get sequence
Deep sequencing
1038773 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 75463716-75463810 [+]
sense
OTTMUST00000073516 ; Tlcd2-004; exon 2
OTTMUST00000013984 ; RP23-384C18.7-002; exon 2
OTTMUST00000013983 ; RP23-384C18.7-001; exon 2
ENSMUST00000124718 ; Tlcd2-004; exon 2
ENSMUST00000134345 ; 2210403K04Rik-002; exon 2
ENSMUST00000149940 ; 2210403K04Rik-001; exon 2
Database links

Mature sequence mmu-miR-22-5p

Accession MIMAT0004629
Previous IDs mmu-miR-22*
Sequence

19 - 

aguucuucaguggcaagcuuua

 - 40

Get sequence
Deep sequencing 10552 reads, 82 experiments
Evidence experimental; cloned [5], Solexa [6-7]
Predicted targets

Mature sequence mmu-miR-22-3p

Accession MIMAT0000531
Previous IDs mmu-miR-22
Sequence

57 - 

aagcugccaguugaagaacugu

 - 78

Get sequence
Deep sequencing 909906 reads, 82 experiments
Evidence experimental; cloned [1-2,4-5], Northern [2], Solexa [6-7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).