Stem-loop sequence mmu-mir-22

AccessionMI0000570 (change log)
Symbol MGI:Mir22
DescriptionMus musculus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

120 open access papers mention mmu-mir-22
(899 sentences)

Stem-loop
   a  --u   u   cc               -     a      u  ccu 
5'  cc   ggc gag  gcaguaguucuucag uggca gcuuua gu   g
    ||   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3'  gg   ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
   c  ucc   u   -c               g     -      -  acc 
Get sequence
Deep sequencing
3015381 reads, 1.16e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 75463716-75463810 [+]
sense
OTTMUST00000013983 ; Mir22hg-001; exon 2
OTTMUST00000013984 ; Mir22hg-002; exon 2
OTTMUST00000073516 ; Tlcd2-004; exon 2
ENSMUST00000149940 ; Mir22hg-001; exon 2
ENSMUST00000134345 ; Mir22hg-002; exon 2
ENSMUST00000124718 ; Tlcd2-004; exon 2
Database links

Mature sequence mmu-miR-22-5p

Accession MIMAT0004629
Previous IDsmmu-miR-22*
Sequence

19 - 

aguucuucaguggcaagcuuua

 - 40

Get sequence
Deep sequencing17097 reads, 106 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-22-3p

Accession MIMAT0000531
Previous IDsmmu-miR-22
Sequence

57 - 

aagcugccaguugaagaacugu

 - 78

Get sequence
Deep sequencing2998275 reads, 108 experiments
Evidence experimental; cloned [1-2,4-5], Northern [2], Illumina [6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).