Stem-loop sequence mmu-mir-21a

AccessionMI0000569
Previous IDsmmu-mir-21
Symbol MGI:Mir21
DescriptionMus musculus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u      ccu                a     a     a    u a 
5'  guacca   ugucggauagcuuauc gacug uguug cugu g a
    ||||||   |||||||||||||||| ||||| ||||| |||| | u
3'  uauggu   acagucugucggguag cugac acaac ggua c c
   c      uuu                -     g     -    - u 
Get sequence
Deep sequencing
8483098 reads, 4.12e+04 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 86584067-86584158 [-]
sense
OTTMUST00000002400 ; Vmp1-001; 3'UTR (exon 12)
ENSMUST00000018315 ; Vmp1-001; 3'UTR (exon 12)
Database links

Mature sequence mmu-miR-21a-5p

Accession MIMAT0000530
Previous IDsmmu-miR-21;mmu-miR-21-5p
Sequence

18 - 

uagcuuaucagacugauguuga

 - 39

Get sequence
Deep sequencing6789849 reads, 93 experiments
Evidence experimental; cloned [1-2,4-6], Northern [2], Illumina [8]
Validated targets
Predicted targets

Mature sequence mmu-miR-21a-3p

Accession MIMAT0004628
Previous IDsmmu-miR-21*;mmu-miR-21-3p
Sequence

56 - 

caacagcagucgaugggcuguc

 - 77

Get sequence
Deep sequencing40493 reads, 85 experiments
Evidence experimental; cloned [6], Illumina [8-9]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
8
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
9
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).