Stem-loop sequence mmu-mir-20a

AccessionMI0000568 (change log)
Previous IDsmmu-mir-20
Symbol MGI:Mir20a
DescriptionMus musculus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

168 open access papers mention mmu-mir-20a
(958 sentences)

Stem-loop
   g  u  u  --g      ucu    c   -a       ua        g   u   u 
5'  ug ga gu   acagcu   guag acu  aagugcu  uagugcag uag gug a
    || || ||   ||||||   |||| |||  |||||||  |||||||| ||| |||  
3'  ac cu ca   ugucga   cguc uga  uucacga  auuacguc auc uac g
   g  -  -  aga      --c    a   aa       gc        -   -   c 
Get sequence
Deep sequencing
272603 reads, 1.74e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 115044157-115044263 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-20a
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-20a-5p

Accession MIMAT0000529
Previous IDsmmu-miR-20;mmu-miR-20a
Sequence

27 - 

uaaagugcuuauagugcagguag

 - 49

Get sequence
Deep sequencing269740 reads, 107 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-20a-3p

Accession MIMAT0004627
Previous IDsmmu-miR-20a*
Sequence

63 - 

acugcauuacgagcacuuaaag

 - 84

Get sequence
Deep sequencing2581 reads, 91 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).