Stem-loop sequence mmu-mir-18a

Accession MI0000567
Previous IDs mmu-mir-18
Symbol MGI:Mirn18
Description Mus musculus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     -        u   --   u   uc   u    a   -  -a  u 
 gcgug cuuuuugu cua  agg gca  uag gcag uag ug  ag a
 ||||| |||||||| |||  ||| |||  ||| |||| ||| ||  ||  
 uguau gaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
c     u        c   cu   u   ga   c    -   u  ga  a 
Get sequence
Deep sequencing
754877 reads, 95 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 115043851-115043946 [+]
sense
OTTMUST00000083388 ; Mirhg1-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-18a
mmu-mir-17 chr14: 115043671-115043754 [+]
mmu-mir-18a chr14: 115043851-115043946 [+]
mmu-mir-19a chr14: 115044000-115044081 [+]
mmu-mir-20a chr14: 115044157-115044263 [+]
mmu-mir-19b-1 chr14: 115044305-115044391 [+]
mmu-mir-92a-1 chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-18a-5p

Accession MIMAT0000528
Previous IDs mmu-miR-18;mmu-miR-18a
Sequence

17 - 

uaaggugcaucuagugcagauag

 - 39

Get sequence
Deep sequencing 75532 reads, 79 experiments
Evidence experimental; cloned [1-3], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-18a-3p

Accession MIMAT0004626
Previous IDs mmu-miR-18a*
Sequence

58 - 

acugcccuaagugcuccuucug

 - 79

Get sequence
Deep sequencing 3168 reads, 72 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).