Stem-loop sequence mmu-mir-18a

AccessionMI0000567 (change log)
Previous IDsmmu-mir-18
Symbol MGI:Mir18
DescriptionMus musculus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

122 open access papers mention mmu-mir-18a
(534 sentences)

Stem-loop
   u     -        u   --   u   uc   u    a   -  -a  u 
5'  gcgug cuuuuugu cua  agg gca  uag gcag uag ug  ag a
    ||||| |||||||| |||  ||| |||  ||| |||| ||| ||  ||  
3'  uguau gaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
   c     u        c   cu   u   ga   c    -   u  ga  a 
Get sequence
Deep sequencing
111430 reads, 752 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 115043851-115043946 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-18a
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-18a-5p

Accession MIMAT0000528
Previous IDsmmu-miR-18;mmu-miR-18a
Sequence

17 - 

uaaggugcaucuagugcagauag

 - 39

Get sequence
Deep sequencing105671 reads, 104 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-18a-3p

Accession MIMAT0004626
Previous IDsmmu-miR-18a*
Sequence

58 - 

acugcccuaagugcuccuucug

 - 79

Get sequence
Deep sequencing5728 reads, 96 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).