Stem-loop sequence mmu-mir-18a

AccessionMI0000567
Previous IDsmmu-mir-18
Symbol MGI:Mirn18
DescriptionMus musculus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u     -        u   --   u   uc   u    a   -  -a  u 
5'  gcgug cuuuuugu cua  agg gca  uag gcag uag ug  ag a
    ||||| |||||||| |||  ||| |||  ||| |||| ||| ||  ||  
3'  uguau gaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
   c     u        c   cu   u   ga   c    -   u  ga  a 
Get sequence
Deep sequencing
755421 reads, 1.28e+03 reads per million, 106 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 115043851-115043946 [+]
sense
OTTMUST00000083388 ; Mir17hg-001; exon 2
ENSMUST00000134140 ; Mir17hg-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-18a
mmu-mir-17chr14: 115043671-115043754 [+]
mmu-mir-18achr14: 115043851-115043946 [+]
mmu-mir-19achr14: 115044000-115044081 [+]
mmu-mir-20achr14: 115044157-115044263 [+]
mmu-mir-19b-1chr14: 115044305-115044391 [+]
mmu-mir-92a-1chr14: 115044427-115044506 [+]
Database links

Mature sequence mmu-miR-18a-5p

Accession MIMAT0000528
Previous IDsmmu-miR-18;mmu-miR-18a
Sequence

17 - 

uaaggugcaucuagugcagauag

 - 39

Get sequence
Deep sequencing67364 reads, 83 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-18a-3p

Accession MIMAT0004626
Previous IDsmmu-miR-18a*
Sequence

58 - 

acugcccuaagugcuccuucug

 - 79

Get sequence
Deep sequencing2572 reads, 72 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).