Stem-loop sequence mmu-mir-18a

Accession

MI0000567 (change log)

Previous IDs

mmu-mir-18

Symbol

MGI:Mir18

Description

Mus musculus miR-18a stem-loop

Gene family

MIPF0000001; mir-17

Literature search

122 open access papers mention mmu-mir-18a
(534 sentences)

Stem-loop

   u     -        u   --   u   uc   u    a   -  -a  u 
5'  gcgug cuuuuugu cua  agg gca  uag gcag uag ug  ag a
    ||||| |||||||| |||  ||| |||  ||| |||| ||| ||  ||  
3'  uguau gaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
   c     u        c   cu   u   ga   c    -   u  ga  a 

Deep sequencing

111430 reads, 752 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr14: 115043851-115043946 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000083388 ; Mir17hg-001; exon 2

  ENSMUST00000134140 ; Mir17hg-001; exon 2

Clustered miRNAs

< 10kb from mmu-mir-18a

• mmu-mir-17: chr14: 115043671-115043754 [+]
• mmu-mir-18a: chr14: 115043851-115043946 [+]
• mmu-mir-19a: chr14: 115044000-115044081 [+]
• mmu-mir-20a: chr14: 115044157-115044263 [+]
• mmu-mir-19b-1: chr14: 115044305-115044391 [+]
• mmu-mir-92a-1: chr14: 115044427-115044506 [+]

Database links

• EntrezGene:Mir18
• MGI:Mir18
• RNAcentral:URS000075CBC1_10090
• miRBase Tracker:MI0000567

Mature sequence mmu-miR-18a-5p

• Accession: MIMAT0000528
• Previous IDs: mmu-miR-18;mmu-miR-18a
• Sequence: 17 - uaaggugcaucuagugcagauag - 39
• Deep sequencing: 105671 reads, 104 experiments
• Evidence: experimental; cloned [1-3], Illumina [4-5]
• Database links:
  • RNAcentral:URS000035CC3E_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-18a-5p
  • miRDB:mmu-miR-18a-5p
  • microrna.org:mmu-miR-18a-5p

Mature sequence mmu-miR-18a-3p

• Accession: MIMAT0004626
• Previous IDs: mmu-miR-18a*
• Sequence: 58 - acugcccuaagugcuccuucug - 79
• Deep sequencing: 5728 reads, 96 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00005ACB9D_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-18a-3p
  • miRDB:mmu-miR-18a-3p
  • microrna.org:mmu-miR-18a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).