![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-18a |
||||||||||||||
Accession | MI0000567 (change log) | |||||||||||||
Previous IDs | mmu-mir-18 | |||||||||||||
Symbol | MGI:Mir18 | |||||||||||||
Description | Mus musculus miR-18a stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
![]()
122 open access papers mention mmu-mir-18a | |||||||||||||
Stem-loop |
u - u -- u uc u a - -a u 5' gcgug cuuuuugu cua agg gca uag gcag uag ug ag a ||||| |||||||| ||| ||| ||| ||| |||| ||| || || 3' uguau gaagaaua ggu ucc cgu auc cguc auc ac uc g c u c cu u ga c - u ga a |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence mmu-miR-18a-5p |
|
Accession | MIMAT0000528 |
Previous IDs | mmu-miR-18;mmu-miR-18a |
Sequence |
17 - uaaggugcaucuagugcagauag - 39 |
Deep sequencing | 105671 reads, 104 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-18a-3p |
|
Accession | MIMAT0004626 |
Previous IDs | mmu-miR-18a* |
Sequence |
58 - acugcccuaagugcuccuucug - 79 |
Deep sequencing | 5728 reads, 96 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|