Stem-loop sequence mmu-mir-16-2

AccessionMI0000566
Symbol MGI:Mir16-2
DescriptionMus musculus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c  g     uc    cu         ua        c  ag   aau 
5'  au cuugu  cacu  agcagcacg  aauauugg gu  uga   a
    || |||||  ||||  |||||||||  |||||||| ||  |||    
3'  ua ggaca  guga  ucgucgugu  uuauaacc ca  auu   a
   a  g     gu    uu         ua        a  -a   aua 
Get sequence
Deep sequencing
2712435 reads, 4.63e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr3: 69009902-69009996 [+]
sense
OTTMUST00000060029 ; Smc4-001; intron 5
OTTMUST00000060031 ; Smc4-003; intron 5
OTTMUST00000060032 ; Smc4-004; intron 5
OTTMUST00000060030 ; Smc4-002; intron 5
ENSMUST00000148385 ; Smc4-002; intron 5
ENSMUST00000107803 ; Smc4-004; intron 5
ENSMUST00000136502 ; Smc4-003; intron 5
ENSMUST00000042901 ; Smc4-001; intron 5
Clustered miRNAs
< 10kb from mmu-mir-16-2
mmu-mir-15bchr3: 69009772-69009835 [+]
mmu-mir-16-2chr3: 69009902-69009996 [+]
Database links

Mature sequence mmu-miR-16-5p

Accession MIMAT0000527
Previous IDsmmu-miR-16
Sequence

17 - 

uagcagcacguaaauauuggcg

 - 38

Get sequence
Deep sequencing1148745 reads, 92 experiments
Evidence experimental; cloned [1-2,4-5], Northern [2], Illumina [6,8]
Validated targets
Predicted targets

Mature sequence mmu-miR-16-2-3p

Accession MIMAT0017018
Previous IDsmmu-miR-16-2*
Sequence

59 - 

accaauauuauugugcugcuuu

 - 80

Get sequence
Deep sequencing1769 reads, 67 experiments
Evidence experimental; 454 [7], Illumina [8]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).