Stem-loop sequence mmu-mir-16-1

Accession MI0000565
Symbol MGI:Mir16-1
Description Mus musculus miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a       gg   c          -  a        c u   gauu 
 ugucagc  ugc uuagcagcac gu aauauugg g uaa    c
 |||||||  ||| |||||||||| || |||||||| | |||     
 acgguug  aug agucgucgug ca uuaugacc c auu    u
a       ga   a          u  g        u c   aaag 
Get sequence
Deep sequencing
2694132 reads, 97 experiments
Comments

This sequence is a clear homologue of human mir-16 and maps to mouse chromosome 14 [1]. A search of NCBIM30 genome assembly suggests a possible second hairpin precursor for miR-16 (MI0000566 ).

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 61631880-61631972 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-16-1
mmu-mir-15a chr14: 61632027-61632110 [-]
mmu-mir-16-1 chr14: 61631880-61631972 [-]
Database links

Mature sequence mmu-miR-16-5p

Accession MIMAT0000527
Previous IDs mmu-miR-16
Sequence

16 - 

uagcagcacguaaauauuggcg

 - 37

Get sequence
Deep sequencing 1196144 reads, 82 experiments
Evidence experimental; cloned [1-2,4-5], Northern [2], Solexa [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-16-1-3p

Accession MIMAT0004625
Previous IDs mmu-miR-16*;mmu-miR-16-1*
Sequence

58 - 

ccaguauugacugugcugcuga

 - 79

Get sequence
Deep sequencing 7456 reads, 77 experiments
Evidence experimental; cloned [5], Solexa [6-7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).