Stem-loop sequence mmu-mir-15a

AccessionMI0000564 (change log)
Symbol MGI:Mir15a
DescriptionMus musculus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

198 open access papers mention mmu-mir-15a
(723 sentences)

Stem-loop
   c     gaguaaa ua        ua          ga gu 
5'  ccuug       g  gcagcaca  augguuugug  u  u
    |||||       |  ||||||||  ||||||||||  |  g
3'  ggaac       c  cgucgugu  uaccggacgu  a  a
   a     -auaaaa uc        ca          gg aa 
Get sequence
Deep sequencing
490286 reads, 2.82e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 61632027-61632110 [-]
sense
OTTMUST00000113484 ; Dleu2-014; intron 3
OTTMUST00000113481 ; Dleu2-001; intron 4
OTTMUST00000113482 ; Dleu2-004; intron 4
OTTMUST00000113483 ; Dleu2-013; intron 4
OTTMUST00000113485 ; Dleu2-006; intron 4
OTTMUST00000113487 ; Dleu2-002; intron 4
OTTMUST00000113488 ; Dleu2-015; intron 4
OTTMUST00000113490 ; Dleu2-003; intron 4
ENSMUST00000183054 ; Dleu2-014; intron 3
ENSMUST00000182768 ; Dleu2-001; intron 4
ENSMUST00000182259 ; Dleu2-004; intron 4
ENSMUST00000183066 ; Dleu2-013; intron 4
ENSMUST00000182325 ; Dleu2-006; intron 4
ENSMUST00000180377 ; Dleu2-002; intron 4
ENSMUST00000183079 ; Dleu2-015; intron 4
ENSMUST00000183245 ; Dleu2-003; intron 4
Clustered miRNAs
< 10kb from mmu-mir-15a
mmu-mir-15achr14: 61632027-61632110 [-]
mmu-mir-16-1chr14: 61631880-61631972 [-]
Database links

Mature sequence mmu-miR-15a-5p

Accession MIMAT0000526
Previous IDsmmu-miR-15a
Sequence

15 - 

uagcagcacauaaugguuugug

 - 36

Get sequence
Deep sequencing486896 reads, 107 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-miR-15a-3p

Accession MIMAT0004624
Previous IDsmmu-miR-15a*
Sequence

52 - 

caggccauacugugcugccuca

 - 73

Get sequence
Deep sequencing3372 reads, 92 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).