Stem-loop sequence mmu-mir-15a

AccessionMI0000564
Symbol MGI:Mir15a
DescriptionMus musculus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-15_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-15 microRNA precursor family is made up of small non-coding RNA genes that regulate gene expression. The family includes the related mir-15a and mir-15b sequences, as well as miR-16-1, miR-16-2, miR-195 and miR-497. These six highly conserved miRNAs are clustered on three separate chromosomes. In humans miR-15a and miR-16 are clustered within 0.5 kilobases at chromosome position 13q14. This region has been found to be the most commonly affected in chronic lymphocytic leukaemia (CLL), with deletions of the entire region in more than half of cases. Both miR-15a and miR-16 are thus frequently deleted or down-regulated in CLL samples with 13q14 deletions; occurring in more than two thirds of CLL cases. miR-15a/16-1 deletion has been shown to accelerate the proliferation of both human and mouse B-cells through modulation of the expression of genes controlling cell cycle progression. Studies have found the miR-15a/16-1 microRNA cluster to function as a tumour suppressor, with the oncogene BCL2 as its target. Specifically, miR-15a/16-1 downregulates BCL2 expression and is itself deleted or downregulated in tumour cells. There is a marked increase in BCL2 levels observed in advanced prostate tumour cases, which is inversely correlated with miR-15a/16-1 expression (and so corresponds to a decrease in miR-15a/16-1 levels). Inhibition of cell proliferation by the miR-15a/16-1 cluster occurs in both lymphoid and non-lymphoid tissue. The miR-15a/16-1 cluster has further been found to be highly expressed in CD5+ cells, therefore hinting at an important role of miR-15/16 in normal CD5+ B-cell homeostasis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c     gaguaaa ua        ua          ga gu 
5'  ccuug       g  gcagcaca  augguuugug  u  u
    |||||       |  ||||||||  ||||||||||  |  g
3'  ggaac       c  cgucgugu  uaccggacgu  a  a
   a     -auaaaa uc        ca          gg aa 
Get sequence
Deep sequencing
780965 reads, 2.69e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr14: 61632027-61632110 [-]
sense
OTTMUST00000113484 ; Dleu2-014; intron 3
OTTMUST00000113481 ; Dleu2-001; intron 4
OTTMUST00000113482 ; Dleu2-004; intron 4
OTTMUST00000113483 ; Dleu2-013; intron 4
OTTMUST00000113485 ; Dleu2-006; intron 4
OTTMUST00000113487 ; Dleu2-002; intron 4
OTTMUST00000113488 ; Dleu2-015; intron 4
OTTMUST00000113490 ; Dleu2-003; intron 4
ENSMUST00000183054 ; Dleu2-014; intron 3
ENSMUST00000182768 ; Dleu2-001; intron 4
ENSMUST00000182259 ; Dleu2-004; intron 4
ENSMUST00000183066 ; Dleu2-013; intron 4
ENSMUST00000182325 ; Dleu2-006; intron 4
ENSMUST00000180377 ; Dleu2-002; intron 4
ENSMUST00000183079 ; Dleu2-015; intron 4
ENSMUST00000183245 ; Dleu2-003; intron 4
Clustered miRNAs
< 10kb from mmu-mir-15a
mmu-mir-15achr14: 61632027-61632110 [-]
mmu-mir-16-1chr14: 61631880-61631972 [-]
Database links

Mature sequence mmu-miR-15a-5p

Accession MIMAT0000526
Previous IDsmmu-miR-15a
Sequence

15 - 

uagcagcacauaaugguuugug

 - 36

Get sequence
Deep sequencing124935 reads, 91 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Illumina [6-7]
Validated targets
Predicted targets

Mature sequence mmu-miR-15a-3p

Accession MIMAT0004624
Previous IDsmmu-miR-15a*
Sequence

52 - 

caggccauacugugcugccuca

 - 73

Get sequence
Deep sequencing1880 reads, 74 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).