miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000563

Accession MI0000563
ID mmu-let-7f-2
Symbol MGI:Mirlet7f2
Description Mus musculus let-7f-2 stem-loop
Stem-loop 
u      u   gu                uuagggucauac 
 guggga gag  aguagauuguauaguu            c
 |||||| |||  ||||||||||||||||             
 cacccu uuc  ucaucugacauaucaa            c
g      -   ug                uagagguucuac
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
X: 148346889-148346971 [+]
sense
OTTMUST00000046396 ; Huwe1-001; intron 57
OTTMUST00000046226 ; Huwe1-002; intron 59
ENSMUST00000112622 ; Huwe1-001; intron 57
ENSMUST00000026292 ; Huwe1-002; intron 59

View flanking features
Clustered miRNAs
< 10kb from mmu-let-7f-2
mmu-let-7f-2 X: 148346889-148346971 [+]
mmu-mir-98 X: 148347757-148347864 [+]
Database links
Gene family

MIPF0000002; let-7

Mature sequence MIMAT0000525

Accession MIMAT0000525
ID mmu-let-7f
Sequence

8 -  

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence experimental; cloned [1-4]
Predicted targets

References

1
"Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
"A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).