Stem-loop sequence mmu-let-7f-1

AccessionMI0000562
Symbol MGI:Mirlet7f1
DescriptionMus musculus let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a    a ug                      ---------       u 
5'  ucag g  agguaguagauuguauaguugu         gggguag g
    |||| |  ||||||||||||||||||||||         ||||||| a
3'  aguc c  uccguuaucuaacauaucaaua         ucccauu u
   g    - cu                      gaggauuug       u 
Get sequence
Deep sequencing
81376982 reads, 2.43e+05 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr13: 48537829-48537917 [-]
antisense
ENSMUST00000175491 ; Gm24111-201; exon 1
Clustered miRNAs
< 10kb from mmu-let-7f-1
mmu-let-7a-1chr13: 48538179-48538272 [-]
mmu-let-7f-1chr13: 48537829-48537917 [-]
mmu-let-7dchr13: 48536012-48536114 [-]
Database links

Mature sequence mmu-let-7f-5p

Accession MIMAT0000525
Previous IDsmmu-let-7f
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing85510546 reads, 93 experiments
Evidence experimental; cloned [1-4], Illumina [5,7]
Predicted targets

Mature sequence mmu-let-7f-1-3p

Accession MIMAT0004623
Previous IDsmmu-let-7f*;mmu-let-7f-1*
Sequence

64 - 

cuauacaaucuauugccuuccc

 - 85

Get sequence
Deep sequencing1234 reads, 63 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).