Stem-loop sequence mmu-let-7f-1

AccessionMI0000562 (change log)
Symbol MGI:Mirlet7f-1
DescriptionMus musculus let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

422 open access papers mention mmu-let-7f-1
(2167 sentences)

Stem-loop
   a    a ug                      ---------       u 
5'  ucag g  agguaguagauuguauaguugu         gggguag g
    |||| |  ||||||||||||||||||||||         ||||||| a
3'  aguc c  uccguuaucuaacauaucaaua         ucccauu u
   g    - cu                      gaggauuug       u 
Get sequence
Deep sequencing
108818151 reads, 2.21e+05 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 48537829-48537917 [-]
antisense
ENSMUST00000175491 ; Gm24111-201; exon 1
Clustered miRNAs
< 10kb from mmu-let-7f-1
mmu-let-7a-1chr13: 48538179-48538272 [-]
mmu-let-7f-1chr13: 48537829-48537917 [-]
mmu-let-7dchr13: 48536012-48536114 [-]
Database links

Mature sequence mmu-let-7f-5p

Accession MIMAT0000525
Previous IDsmmu-let-7f
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing218862443 reads, 109 experiments
Evidence experimental; cloned [1-4], Illumina [5,7]
Database links
Predicted targets

Mature sequence mmu-let-7f-1-3p

Accession MIMAT0004623
Previous IDsmmu-let-7f*;mmu-let-7f-1*
Sequence

64 - 

cuauacaaucuauugccuuccc

 - 85

Get sequence
Deep sequencing2822 reads, 86 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).