Stem-loop sequence mmu-let-7c-2

AccessionMI0000560 (change log)
Symbol MGI:Mirlet7c-2
DescriptionMus musculus let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

431 open access papers mention mmu-let-7c-2
(2337 sentences)

Stem-loop
   a     -   g   u   gu                uugggcucugc 
5'  cggcc uuu ggg gag  aguagguuguaugguu           c
    ||||| ||| ||| |||  ||||||||||||||||            
3'  gccgg gaa ucc uuc  ucaucuaacauaucaa           c
   c     u   g   u   ug                uggcgucucgc 
Get sequence
Deep sequencing
119449107 reads, 2.32e+05 reads per million, 109 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 85706603-85706697 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-let-7c-2
mmu-let-7c-2chr15: 85706603-85706697 [+]
mmu-let-7bchr15: 85707319-85707403 [+]
Database links

Mature sequence mmu-let-7c-5p

Accession MIMAT0000523
Previous IDsmmu-let-7c
Sequence

14 - 

ugagguaguagguuguaugguu

 - 35

Get sequence
Deep sequencing238745569 reads, 109 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

Mature sequence mmu-let-7c-2-3p

Accession MIMAT0005439
Previous IDsmmu-let-7c-2*
Sequence

62 - 

cuauacaaucuacugucuuucc

 - 83

Get sequence
Deep sequencing10130 reads, 105 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).