Stem-loop sequence mmu-let-7c-1

Accession MI0000559
Symbol MGI:Mirlet7c-1
Description Mus musculus let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u      a      uu   g   u             ua  g ua a 
 gugugc uccggg  gag uag agguuguaugguu  ga u  c c
 |||||| ||||||  ||| ||| |||||||||||||  || |  | c
 cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
u      -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
89889774 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 77599657-77599750 [+]
antisense
ENSMUST00000114231 ; Gm11146-201; intron 1
Clustered miRNAs
< 10kb from mmu-let-7c-1
mmu-mir-99a chr16: 77598936-77599000 [+]
mmu-let-7c-1 chr16: 77599657-77599750 [+]
Database links

Mature sequence mmu-let-7c-5p

Accession MIMAT0000523
Previous IDs mmu-let-7c
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Deep sequencing 179134723 reads, 82 experiments
Evidence experimental; cloned [1,3-5], Northern [2], Solexa [6-7]
Validated targets
Predicted targets

Mature sequence mmu-let-7c-1-3p

Accession MIMAT0004622
Previous IDs mmu-let-7c-1*
Sequence

61 - 

cuguacaaccuucuagcuuucc

 - 82

Get sequence
Deep sequencing 109 reads, 24 experiments
Evidence experimental; cloned [5], Solexa [6-7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).