Stem-loop sequence mmu-let-7b

AccessionMI0000558 (change log)
Symbol MGI:Mirlet7b
DescriptionMus musculus let-7b stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   g     u                     ----  ---a      u 
5'  caggg gagguaguagguugugugguu    uc    gggcag g
    ||||| |||||||||||||||||||||    ||    |||||| a
3'  guccc uuccgucauccaacauaucaa    ag    cccguu u
   a     -                     uaga  ccuc      g 
Get sequence
Deep sequencing
45787752 reads, 1.42e+05 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 85707319-85707403 [+]
Clustered miRNAs
< 10kb from mmu-let-7b
mmu-let-7c-2chr15: 85706603-85706697 [+]
mmu-let-7bchr15: 85707319-85707403 [+]
Database links

Mature sequence mmu-let-7b-5p

Accession MIMAT0000522
Previous IDsmmu-let-7b

7 - 


 - 28

Get sequence
Deep sequencing45786999 reads, 76 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-let-7b-3p

Accession MIMAT0004621
Previous IDsmmu-let-7b*

61 - 


 - 82

Get sequence
Deep sequencing705 reads, 67 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets


PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).