Stem-loop sequence mmu-let-7b

AccessionMI0000558 (change log)
Symbol MGI:Mirlet7b
DescriptionMus musculus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

448 open access papers mention mmu-let-7b
(2489 sentences)

Stem-loop
   g     u                     ----  ---a      u 
5'  caggg gagguaguagguugugugguu    uc    gggcag g
    ||||| |||||||||||||||||||||    ||    |||||| a
3'  guccc uuccgucauccaacauaucaa    ag    cccguu u
   a     -                     uaga  ccuc      g 
Get sequence
Deep sequencing
67093675 reads, 1.2e+05 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 85707319-85707403 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-let-7b
mmu-let-7c-2chr15: 85706603-85706697 [+]
mmu-let-7bchr15: 85707319-85707403 [+]
Database links

Mature sequence mmu-let-7b-5p

Accession MIMAT0000522
Previous IDsmmu-let-7b
Sequence

7 - 

ugagguaguagguugugugguu

 - 28

Get sequence
Deep sequencing67086878 reads, 107 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-let-7b-3p

Accession MIMAT0004621
Previous IDsmmu-let-7b*
Sequence

61 - 

cuauacaaccuacugccuuccc

 - 82

Get sequence
Deep sequencing6760 reads, 97 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).