miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000556

Accession MI0000556
ID mmu-let-7a-1
Symbol MGI:Mirlet7a-1
Description Mus musculus let-7a-1 stem-loop
Stem-loop 
u     g     u   gu                uuagggucacac 
 ucacu uggga gag  aguagguuguauaguu            c
 ||||| ||||| |||  ||||||||||||||||            c
 agugg auccu uuc  ucaucuaacauaucaa            a
u     a     -   ug                uagagggucacc
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
13: 48633548-48633641 [-]
intergenic

View flanking features
Clustered miRNAs
< 10kb from mmu-let-7a-1
mmu-let-7a-1 13: 48633548-48633641 [-]
mmu-let-7f-1 13: 48633198-48633286 [-]
mmu-let-7d 13: 48631381-48631483 [-]
Database links
Gene family

MIPF0000002; let-7

Mature sequence MIMAT0000521

Accession MIMAT0000521
ID mmu-let-7a
Sequence

13 -  

ugagguaguagguuguauaguu

 - 34

Get sequence
Evidence experimental; cloned [1-4]
Predicted targets

Minor miR* sequence MIMAT0004620

Accession MIMAT0004620
ID mmu-let-7a*
Sequence

64 -  

cuauacaaucuacugucuuucc

 - 85

Get sequence
Evidence experimental; cloned [4]
Predicted targets

References

1
"Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
"A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).