Stem-loop sequence mmu-mir-208a

Accession

MI0000555

Previous IDs

mmu-mir-208

Symbol

MGI:Mir208a

Description

Mus musculus miR-208a stem-loop

Gene family

MIPF0000178; mir-208

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Stem-loop

u         g  ug       g  c  gg      c  a 
 uccuuugac gg  agcuuuu gc cg  uuauac ug c
 ||||||||| ||  ||||||| || ||  |||||| || a
 aggagacug uu  ucgaaaa cg gc  aauaug ac c
g         g  gu       a  a  ag      c  u 

Deep sequencing

11860 reads, 34 experiments

Genome context

• Coordinates (GRCm38): chr14: 54949060-54949142 [-]
• Overlapping transcripts:

  sense

  ENSMUST00000081857 ; Myh6-201; intron 29

Database links

• EMBL: AJ560749;MMU560749
• ENTREZGENE: 387204;Mir208a
• MGI: 2676883;Mir208a

Mature sequence mmu-miR-208a-5p

• Accession: MIMAT0017014
• Sequence: 15 - gagcuuuuggcccggguuauac - 36
• Deep sequencing: 215 reads, 17 experiments
• Evidence: experimental; Solexa [3]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-208a-5p
  • MIRDB:mmu-miR-208a-5p
  • RNA22-MMU:mmu-miR-208a-5p

Mature sequence mmu-miR-208a-3p

• Accession: MIMAT0000520
• Previous IDs: mmu-miR-208;mmu-miR-208a
• Sequence: 50 - auaagacgagcaaaaagcuugu - 71
• Deep sequencing: 404 reads, 22 experiments
• Evidence: experimental; cloned [1-2], Solexa [3]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-208a-3p
  • MICRORNA.ORG:mmu-miR-208a-3p
  • MIRDB:mmu-miR-208a-3p
  • RNA22-MMU:mmu-miR-208a-3p
  • TARGETSCAN-VERT:mmu-miR-208a

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).