Stem-loop sequence mmu-mir-208a

AccessionMI0000555 (change log)
Previous IDsmmu-mir-208
Symbol MGI:Mir208a
DescriptionMus musculus miR-208a stem-loop
Gene family MIPF0000178; mir-208
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u         g  ug       g  c  gg      c  a 
5'  uccuuugac gg  agcuuuu gc cg  uuauac ug c
    ||||||||| ||  ||||||| || ||  |||||| || a
3'  aggagacug uu  ucgaaaa cg gc  aauaug ac c
   g         g  gu       a  a  ag      c  u 
Get sequence
Deep sequencing
419 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 54949060-54949142 [-]
sense
ENSMUST00000081857 ; Myh6-201; intron 29
Database links

Mature sequence mmu-miR-208a-5p

Accession MIMAT0017014
Sequence

15 - 

gagcuuuuggcccggguuauac

 - 36

Get sequence
Deep sequencing195 reads, 13 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-208a-3p

Accession MIMAT0000520
Previous IDsmmu-miR-208;mmu-miR-208a
Sequence

50 - 

auaagacgagcaaaaagcuugu

 - 71

Get sequence
Deep sequencing222 reads, 22 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).