Stem-loop sequence mmu-mir-200a

AccessionMI0000554 (change log)
Symbol MGI:Mir200a
DescriptionMus musculus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

294 open access papers mention mmu-mir-200a
(1890 sentences)

Stem-loop
   c    - c   g        -             c    uu  uu 
5'  uggg c ucu ugggcauc uuaccggacagug ugga  uc  g
    |||| | ||| |||||||| ||||||||||||| ||||  ||  g
3'  accc g gga acuuguag aauggucugucac aucu  ag  c
   c    a u   a        c             a    -c  uu 
Get sequence
Deep sequencing
260292 reads, 956 reads per million, 99 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 156054896-156054985 [-]
sense
OTTMUST00000117417 ; Ttll10-005; intron 1
OTTMUST00000025771 ; Ttll10-001; intron 1
OTTMUST00000031955 ; RP23-118E21.8-001; intron 1
ENSMUST00000184348 ; Ttll10-005; intron 1
ENSMUST00000097731 ; Ttll10-001; intron 1
ENSMUST00000138361 ; Gm13648-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-200a
mmu-mir-200bchr4: 156055681-156055750 [-]
mmu-mir-200achr4: 156054896-156054985 [-]
mmu-mir-429chr4: 156053905-156053987 [-]
Database links

Mature sequence mmu-miR-200a-5p

Accession MIMAT0004619
Previous IDsmmu-miR-200a*
Sequence

16 - 

caucuuaccggacagugcugga

 - 37

Get sequence
Deep sequencing3965 reads, 71 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-200a-3p

Accession MIMAT0000519
Previous IDsmmu-miR-200a
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing256138 reads, 99 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).