Stem-loop sequence mmu-mir-196a-1

Accession MI0000552
Previous IDs mmu-mir-196-1
Symbol MGI:Mir196a-1
Description Mus musculus miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u    c gg     uga     g     a    c         - gc ugg 
 gagc g  acugu   gugaa uaggu guuu auguuguug g  c   c
 |||| |  |||||   ||||| ||||| |||| ||||||||| |  |   u
 uucg c  ugacg   uacuu gucca caaa uacagcaac c  g   u
c    u au     --g     a     c    c         a aa ucu 
Get sequence
Deep sequencing
415527 reads, 85 experiments
Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 96265164-96265265 [+]
intergenic
Database links

Mature sequence mmu-miR-196a-5p

Accession MIMAT0000518
Previous IDs mmu-miR-196a
Sequence

24 - 

uagguaguuucauguuguuggg

 - 45

Get sequence
Deep sequencing 293422 reads, 70 experiments
Evidence experimental; cloned [1,3], Solexa [4,6]
Validated targets
Predicted targets

Mature sequence mmu-miR-196a-1-3p

Accession MIMAT0017013
Previous IDs mmu-miR-196a-1*
Sequence

62 - 

caacgacaucaaaccaccugau

 - 83

Get sequence
Deep sequencing 243 reads, 25 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).