Stem-loop sequence mmu-mir-192

AccessionMI0000551 (change log)
Symbol MGI:Mir192
DescriptionMus musculus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

91 open access papers mention mmu-mir-192
(520 sentences)

Stem-loop
   c   c   g g  c         -     a       uacucuu 
5'  gug aca g cu ugaccuaug aauug cagccag       u
    ||| ||| | || ||||||||| ||||| |||||||        
3'  cac ugu u ga acuggauac uuaac gucgguc       u
   c   u   a g  c         c     c       uccucuc 
Get sequence
Deep sequencing
2695821 reads, 3.3e+03 reads per million, 103 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 6264844-6264932 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-192
mmu-mir-194-2chr19: 6264643-6264728 [+]
mmu-mir-192chr19: 6264844-6264932 [+]
Database links

Mature sequence mmu-miR-192-5p

Accession MIMAT0000517
Previous IDsmmu-miR-192
Sequence

14 - 

cugaccuaugaauugacagcc

 - 34

Get sequence
Deep sequencing2695314 reads, 103 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-192-3p

Accession MIMAT0017012
Previous IDsmmu-miR-192*
Sequence

57 - 

cugccaauuccauaggucacag

 - 78

Get sequence
Deep sequencing415 reads, 52 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).