Stem-loop sequence mmu-mir-148a

AccessionMI0000550 (change log)
Previous IDsmmu-mir-148
Symbol MGI:Mir148a
DescriptionMus musculus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

96 open access papers mention mmu-mir-148a
(834 sentences)

Stem-loop
   a    guu        u              -  -a    cc    -   ag 
5'  gcca   uggucuuu gagacaaaguucug ag  cacu  gacu cug  u
    ||||   |||||||| |||||||||||||| ||  ||||  |||| |||  a
3'  uggu   gucggaga cucuguuucaagac uc  guga  cuga gau  u
   c    ---        u              a  ac    --    a   ag 
Get sequence
Deep sequencing
2307007 reads, 3.66e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was previsouly named mir-148 here and in [1], but is renamed to avoid confusion with mir-148b (MI0000617). This sequence maps to mouse chromosome 6.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 51269812-51269910 [-]
intergenic
Database links

Mature sequence mmu-miR-148a-5p

Accession MIMAT0004617
Previous IDsmmu-miR-148a*
Sequence

23 - 

aaaguucugagacacuccgacu

 - 44

Get sequence
Deep sequencing30451 reads, 88 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-148a-3p

Accession MIMAT0000516
Previous IDsmmu-miR-148a
Sequence

61 - 

ucagugcacuacagaacuuugu

 - 82

Get sequence
Deep sequencing2276375 reads, 107 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).