Stem-loop sequence mmu-mir-148a

AccessionMI0000550
Previous IDsmmu-mir-148
Symbol MGI:Mir148a
DescriptionMus musculus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a    guu        u              -  -a    cc    -   ag 
5'  gcca   uggucuuu gagacaaaguucug ag  cacu  gacu cug  u
    ||||   |||||||| |||||||||||||| ||  ||||  |||| |||  a
3'  uggu   gucggaga cucuguuucaagac uc  guga  cuga gau  u
   c    ---        u              a  ac    --    a   ag 
Get sequence
Deep sequencing
816996 reads, 2.96e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was previsouly named mir-148 here and in [1], but is renamed to avoid confusion with mir-148b (MI0000617). This sequence maps to mouse chromosome 6.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 51269812-51269910 [-]
intergenic
Database links

Mature sequence mmu-miR-148a-5p

Accession MIMAT0004617
Previous IDsmmu-miR-148a*
Sequence

23 - 

aaaguucugagacacuccgacu

 - 44

Get sequence
Deep sequencing1590 reads, 70 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Predicted targets

Mature sequence mmu-miR-148a-3p

Accession MIMAT0000516
Previous IDsmmu-miR-148a
Sequence

61 - 

ucagugcacuacagaacuuugu

 - 82

Get sequence
Deep sequencing278716 reads, 93 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).