Stem-loop sequence mmu-mir-30d

AccessionMI0000549 (change log)
Symbol MGI:Mir30d
DescriptionMus musculus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

194 open access papers mention mmu-mir-30d
(1057 sentences)

Stem-loop
   a    u   u u         ccc           guaa  c 
5'  aguc gug c guaaacauc   gacuggaagcu    gc a
    |||| ||| | |||||||||   |||||||||||    ||  
3'  ucgg cau g cguuuguag   cugacuuucga    cg c
   c    u   c u         --a           --ac  a 
Get sequence
Deep sequencing
8626901 reads, 1.05e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 68341208-68341289 [-]
sense
OTTMUST00000104147 ; RP23-61D6.1-001; exon 3
ENSMUST00000175699 ; Gm20732-001; exon 3
Clustered miRNAs
< 10kb from mmu-mir-30d
mmu-mir-30dchr15: 68341208-68341289 [-]
mmu-mir-30bchr15: 68337415-68337510 [-]
Database links

Mature sequence mmu-miR-30d-5p

Accession MIMAT0000515
Previous IDsmmu-miR-30d
Sequence

12 - 

uguaaacauccccgacuggaag

 - 33

Get sequence
Deep sequencing8070908 reads, 107 experiments
Evidence experimental; cloned [1,3-5], Illumina [6,8]
Database links
Predicted targets

Mature sequence mmu-miR-30d-3p

Accession MIMAT0017011
Previous IDsmmu-miR-30d*
Sequence

52 - 

cuuucagucagauguuugcugc

 - 73

Get sequence
Deep sequencing555974 reads, 106 experiments
Evidence experimental; 454 [7], Illumina [8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
8
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).