Stem-loop sequence mmu-mir-30c-1

AccessionMI0000547 (change log)
Symbol MGI:Mir30c-1
DescriptionMus musculus miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

211 open access papers mention mmu-mir-30c-1
(1264 sentences)

Stem-loop
   a     uu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Deep sequencing
670942 reads, 1.92e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 120769534-120769622 [-]
sense
OTTMUST00000020133 ; Nfyc-006; intron 3
OTTMUST00000020132 ; Nfyc-005; intron 4
OTTMUST00000020128 ; Nfyc-001; intron 5
OTTMUST00000020129 ; Nfyc-002; intron 5
OTTMUST00000020130 ; Nfyc-003; intron 5
ENSMUST00000134979 ; Nfyc-006; intron 3
ENSMUST00000136236 ; Nfyc-005; intron 4
ENSMUST00000097906 ; Nfyc-201; intron 4
ENSMUST00000043429 ; Nfyc-001; intron 5
ENSMUST00000118902 ; Nfyc-002; intron 5
ENSMUST00000120779 ; Nfyc-003; intron 5
Clustered miRNAs
< 10kb from mmu-mir-30c-1
mmu-mir-30fchr4: 120772606-120772697 [+]
mmu-mir-30echr4: 120772606-120772697 [-]
mmu-mir-30c-1chr4: 120769534-120769622 [-]
Database links

Mature sequence mmu-miR-30c-5p

Accession MIMAT0000514
Previous IDsmmu-miR-30c
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Deep sequencing1298540 reads, 107 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-30c-1-3p

Accession MIMAT0004616
Previous IDsmmu-miR-30c-1*
Sequence

56 - 

cugggagaggguuguuuacucc

 - 77

Get sequence
Deep sequencing21507 reads, 105 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).