Stem-loop sequence mmu-mir-19b-2

AccessionMI0000546 (change log)
Previous IDsmmu-mir-19b
Symbol MGI:Mir19b-2
DescriptionMus musculus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

124 open access papers mention mmu-mir-19b-2
(748 sentences)

Stem-loop
   a                  --        guu    -      g 
5'  cuuacgauuaguuuugca  gauuugca   cagc guauau u
    ||||||||||||||||||  ||||||||   |||| ||||||  
3'  ggguguuagucaaaacgu  cuaaacgu   gucg uauaua g
   a                  ac        ---    g      a 
Get sequence
Deep sequencing
369758 reads, 2.82e+03 reads per million, 107 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-19b was cloned from mouse tissues by independent groups [1,2]. There are two predicted hairpin precursors, with closely related human homologues [4]: mir-19b-1 (MI0000718) on chromosome 14, and mir-19b-2 (previously named mir-19b here, MI0000546) on mouse chromosome X.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52741983-52742066 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-19b-2
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-19b-2-5p

Accession MIMAT0017010
Previous IDsmmu-miR-19b-2*
Sequence

11 - 

aguuuugcagauuugcaguucagc

 - 34

Get sequence
Deep sequencing29 reads, 14 experiments
Evidence experimental; Illumina [7]
Predicted targets

Mature sequence mmu-miR-19b-3p

Accession MIMAT0000513
Previous IDsmmu-miR-19b
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing736255 reads, 107 experiments
Evidence experimental; cloned [1-3,5], Northern [2], Illumina [6,8]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).