Stem-loop sequence mmu-mir-19b-2

AccessionMI0000546
Previous IDsmmu-mir-19b
Symbol MGI:Mir19b-2
DescriptionMus musculus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a                  --        guu    -      g 
5'  cuuacgauuaguuuugca  gauuugca   cagc guauau u
    ||||||||||||||||||  ||||||||   |||| ||||||  
3'  ggguguuagucaaaacgu  cuaaacgu   gucg uauaua g
   a                  ac        ---    g      a 
Get sequence
Deep sequencing
1297145 reads, 4.39e+03 reads per million, 108 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-19b was cloned from mouse tissues by independent groups [1,2]. There are two predicted hairpin precursors, with closely related human homologues [4]: mir-19b-1 (MI0000718) on chromosome 14, and mir-19b-2 (previously named mir-19b here, MI0000546) on mouse chromosome X.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 52741983-52742066 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-19b-2
mmu-mir-106achrX: 52742503-52742567 [-]
mmu-mir-18bchrX: 52742331-52742413 [-]
mmu-mir-20bchrX: 52742113-52742192 [-]
mmu-mir-19b-2chrX: 52741983-52742066 [-]
mmu-mir-92a-2chrX: 52741838-52741928 [-]
mmu-mir-363chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-19b-2-5p

Accession MIMAT0017010
Previous IDsmmu-miR-19b-2*
Sequence

11 - 

aguuuugcagauuugcaguucagc

 - 34

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [7]
Predicted targets

Mature sequence mmu-miR-19b-3p

Accession MIMAT0000513
Previous IDsmmu-miR-19b
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing424258 reads, 90 experiments
Evidence experimental; cloned [1-3,5], Northern [2], Illumina [6,8]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).