Stem-loop sequence ath-MIR319a

Accession MI0000544
Description Arabidopsis thaliana miR319a stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
    a          g      u   c   uc  g u           a -  u   ac        c  aa  c      gccaaaa 
agag gagcuuccuu agucca uca agg  gu a augauucaauu g cu ccg  ucauucau ca  ua cgaguc       u
|||| |||||||||| |||||| ||| |||  || | ||||||||||| | || |||  |||||||| ||  || ||||||        
ucuc cucgagggaa ucaggu agu ucu  ua u uacuagguuaa c ga ggc  aguaagua gu  au gcucag       u
    c          g      u   u   cu  g -           a a  u   gu        a  aa  u      aucaaac 
Get sequence
Deep sequencing
1960 reads, 8 experiments
Comments

The A. thaliana jaw-D mutant has crinkly leaves and fruits, delayed flowering time and greenish petals. The jaw-D phenotype is caused by the over-expression of miR319 (also therefore known as miR-JAW), which is produced from a ~500 base long primary transcript RNA [1]. The mir-JAW microRNA is expressed in two forms, 20 and 21 nt, differing by the presence of the 3' terminal U. Cloned microRNA sequence was obtained from the jaw-D mutant. This miR has been shown targets TCP genes for cleavage [1]. This sequence is located on BAC F9D16. miR-JAW has a homologue located in BAC MBK23 (MI0000545 ). The mature excised miR shows sequence similarity to miR159 (MI0000189 , MI0000218 ).

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr4: 12352956-12353131 [+]
intergenic

Mature sequence ath-miR319a

Accession MIMAT0000511
Sequence

154 - 

uuggacugaagggagcucccu

 - 174

Get sequence
Deep sequencing 1737 reads, 8 experiments
Evidence experimental; Northern [1], 5'RACE [2], cloned [2], 454 [3], Solexa [5]

References

1
PMID:12931144 "Control of leaf morphogenesis by microRNAs" Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D Nature. 425:257-263(2003).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).